Description :
From Genome Similarity Track
Location :
contig_47:266740- 269302
Transcript NameFunction/comments
g9684.t1ETP54552.1 hypothetical protein F442_00778 [Phytophthora parasitica P10297

Sequence
2562 bases(100 bases per row)
TACTTTGTTGATGTACTTGTTCGTGGTACTTCCGTTGATACACTTTCACAATTGTTGACCAGCTCCAGAAACTAATCGCCTATTGCCAGCGCCAATGCTC
GGGAACTGAAAGAGGCCGCGCTTCAGTTGCTTCGTGTTCGTTGCTTTTGCTCGTTTGAATCCGCTGCTTGCTGCTGTACTCTCTTATCAACCGGAGATTT
GACTGTTGCCGCTAATTTTTGCTTGCTATTATATAATAGCTGAGCGACGCATCCAGTACTCTGCGCCAAAGCACCTAGGCGGCATATACGAAGAGGCTGT
TGCGAATAGATACAGCAACCTCGTTCAATGATGGGTGCCAGCTAGTCTGCAGGATCTTCTTCGAGAAATCCAAAGCATCAGGGTCGCCTGGAGCGGGCAT
TGCAGCAATCTGCTGCGCGAGGCCTCGCTGGGGCATGGAGTGCCGGCGGCTCACTCGAGCTGTGCGCGGGGTGATCGAAATATCGGCGCGTCCATAACGG
TCATAAATATGGAACTCGCTGTTATACGAGCCCGTGATGAAGTTGTTGCCATCCCCGCTGACCCCGCACTCGAATTTGTCGAAAATGCAATCACTCTCAT
AAAGATCCCCCAGTCGTGGACGAAGGTGCTCGTGGATCTAGACGTAGGAACAAACACGGTTAGTAAGACCAGCAACACCAGATCACCCTACCAGCTTTCA
ACGCCAATACCGAAGCAGATATTGCACGACTTACATTGATCGTTTGAACCGGACGCGAGTTCATGTTGATGTCCCAGACTTTGAGAGTCAGGAAGTCGCG
TGCAATAATGTAGCGGCCGTCAGGAGAAAACTTAATGTCAGAGATCGACGCGATGATCTCAGAGAAAAAACTTCTGGCTTCAGGATCCTCCTGCTCTTCG
AAAACTGTAGCCCCGTAAGAAGTGTTCCTTATTAGGCACGCTTCACCAGGCCAACAACACAAAAAGTGCATCAGGAACAGTGCGCACCTTGAGAGTACGC
ATCACACAACGCCGCCTGCCGCATATCGCCCAGCTTAATGGCGCCGCGACTCGTGCTATACATCATCGTGTTGCAGTGCGTCGGGTGGAAATCCGCAGCT
GTGATAACCTCCGTGAGCTCTTCCATATTTGCTGGCTTGATGTCCACGATGTCTAACAAAACAACACCACCAACGCACATAAGTTAGAAATGGCATTAGG
CGACAACAAAAGCGAGCATCGACGAACTGAAGCTTTGATTCGAGATGCCCAAGCTCCACAGATTCACACGAAGGTCATCCGCCGACATGAACGTCTCTCC
ATCGCTGTTGATCGCGATCGAGTTGATGTGATACGTATGTGCGTTCGCGTAGACGCGTTTGGCTGTGGACGTCGTCACCTGGCCGCGAACATTGGTCTGT
GGTAGGCGAATGAGCTCTGGTGTGATTTGGGCCCGTGGCACGTGAGCGAGTCCCTGTTCGTTGTACGTGGTGACTTCACGCACGCTTCGCTCGTGTACCT
TCCAGAGTTTGATAGTCTTGTCGTTTGTAGACAGGAGGCACTGGGACCCGTTGGACGGTCGGCACCATTTGATCTGGTTGATCTTTTCCTCGATCTCCAG
ACTTTTGAGGTAGTCGAATTCGGCATTATGGCTCTGGAACTCGGCGTACAGCTGATACTGCGGGTCGTTCATCCCGCTGTACATGGTTTGATTCTGATTT
GGACAACATACAATGTCAGAGGATAAGACCTGCAGGTAAACTCCATAAGAGCACGGACCGACGCAAGGTTTCCATGACGACAGTAAATGGAGACTCGGCC
GCCCTTGTTCCCTGTGGCTAGAAAGTCTCCCGATCGGTCGTACTCAATCGCGGAAATCACCTCGGCTGCAGAGTCATCATCTGCAGTCAATAACCCAGCA
CCCTGAAAGCTGTAACGCCACCGAATCCCTACCTTCAACGAAGCTCCGGGCGCTTTCGCCCGCGGAAAAGACCTGACCCCACTCGGCTTCAGCTTCGCCT
GTGGGTTCTGCCATGTTGACTTCCAAAGCGCCGGCGTTAGTGTGCTTGAGCCTGGTCAGCGCACCCACTCGGCCTTCTTCGCCTCCGATGTCTCCGTGGA
GATTGGTTTGCGTCATGCAGACGCGAGGGGGTTGGGAGCTGCTCTCGACACGACCGTCTGCTTGGCGCTGTAAGAAGCGAAGCTGGCCAACGGACTGCTG
CACCTGCTGCTTTCGCCTTGGGGGTCCTTCTCTTCTTTCGCCGGAGGATCTCGAGGTGTTGCCTCAAAGGCCGCTTTGCTCCTCGGCTGGGGGTTTCGTT
TTTCACGCTAGCAGAAGGGCGGGCGCGACCACTTGGAGAATGGACGGACGAACGCAAGGCGAGGTCAGCACTCGAGGGCTGAAGCGACGACGGCGTCTGA
AGGATCTGCGGTGATGCAAATCCCGTTGTTGCCTGCTGGATGGAGTTGTCACGAGGCGACGAGCTCGAACGATGCGAATGGGGTCCCTCTCAACCGACCA
GACGCTGACAGGCATCGCGATCTTCAATCGCATTTTTTTTTCCATTTTTTGCTATGTACTGC