Description :
From Genome Similarity Track
Location :
Scaffold_175:26671- 31628
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_175-fgenesh-gene-0.8Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_175-snap-gene-0.25Esophageal cancer associated protein, partial

Sequence
4957 bases(100 bases per row)
GATAGATGCTGCTGCTGCTTCTTGGTGCTGCTGCGGGGCTGGCGTGTGGGGATAGTGAGGAAGAGCTGCAGAGGCAAAAGGGGGGAGCGCAAGGCCGCTC
GCTCACCACAAAGGGCGGCGCTCTATTGAGGGCGAGGCACGCGACGCCTGTCAAAATCGATAGGACTGTATGAACAGATACTCTATTCTCAACAAATATG
CAAGATATTTACTGTGATATATTATATACGTACTTGATCAAGATGGAAAGGTACGAGCGAACGCAGTCTCTCTGCCAAGACCTATCTATATTGTATGGAG
GTGTTGTGGTTTGAAATGCCCATTTTGAGCTGCTTTCAGTTTGTTTTATAAAGGTTTCTAGTTTGACTGCTTGGTAGCATTTCAAAAGTAGAATCAGCAG
TTTGCGCACAGCTCTCTGTTATTGACCAATCAGCGTTCAATAAAATGCTGGGTCTCAAATAGTTGCTCTTTTGAGGGTCATCCCTTTCACTTTCCAATTT
AAACAAAAGCATCACCACCCTCAGTCAGCAACTGAAGTGAGAGAGAGAATGTGGGTCAGGCAGGCACTCATGTCTTTGCATCCTGACCGCTGCTGGCCCG
CCCGCCTGCCCGTCGAACTGTGGGCGACTCGCAACACACTACAGACCACCAAACAGTCCCGAAAGTCCCCCCGGAATCTCGCAACGCCTCTGTCATCATG
AGCCTCATCCGCCAGTCGCTCCGCGCCCTGAAGACCGGTACGTTACGTGTTATATAGTAAAGATGTAAAGGAAGGATTGTGCATGGTGCCATGCACACGC
ACGCCACCTGCGCGCGGCTCTTTTGCAATATTGTGTGTGTGTGTGGAAGCATGGTGGCGAATTGTATTGTTGAAATATGCTGACGGTTCTGTAAAATTAT
GTCTGTGTATTGTTGACATGGTGTGTCTATCGCATGTGCAGCCCGCACCCCAGTGGTTGCACTCCGCCCTGCCGCCGCGCGTTTCTCGTCGGCTGCCGCG
CCACAGAACGACGACGACGAGGTCGTGATCCCAGAGCTCCACGGCTCCTTGGAGTGGGTGCTCGAGTCGCCACCACCACTTCACCAGTTCGAGGAGGCGC
CTCTCGTGATCGAGACCTACGGCCCAGTCGACCCAACCCACCACTAGACGCCAACTGTCGAGTGTGTGAGTGTGAAGTGCTACGTCTTTCTAAAGTAAAA
AGCGAGTGGAGAAGACGGTCTCTCGACAGCGCGCGCTCATTTGCTTTCACTGTCAGTGAGCGAATGAATGAAGCGAGAGACTGGATTTGACAGCGAAGCT
GAACAAAAAAAAATTAATAAAGATGAGAGATGCGCCGTGCATTTTGATAAGACGTTGGCTTATTATGCGCTCGCTGTTGCTGCCGCTCTTTGTCTCCAAG
TGTGTTGTTTGGATGCACCACATGCAGGACCCAAGGTTCAGATGAAATGGTCGATTCACTCATTCATTCATTCATTCATTGCCTCGAACTATGTTGAGAG
CAACATGCCGTGCCTGACCCGAGGCGCTCCGTGGTGTCAGCTACTGCCTGGCTACGCAATGGCTGGTTGTCTACATGCATATCTATCGTCGCCATGTTTC
CTTGATGAGTTTGATGTCCGCGAGGTCGTCGTTCAAGATGCTCGTCAGGTGCTCCAGGCCCTGACGTTGCTTGTCCAGGAACTGCGAGAGCAAAGCGAAT
CAAAAGTTAGAGATTGGTCGGGTCAAGATGAACAACAAAGAACGGAACTGGTTTGTACCTGGTACACACGCTGGAGATCCTCGGGGCTGAGCTGGTTCGC
TGGTGGCGCTGGCGCCGCGTCCTGGATGCGCTGAAGCGCCACTGCGTCGTTCAGACGGGCCTTGTACTGCGCTGGCGAGTCCAGCAGCGTTTGCAGTTTC
TTTAGCATCATCCTGCACGAGAGAATGAAAGGCAAATCCAGTAGTTAGAGCGATACCGTAATGCAACATCGACAGAGGAACAGCACAGTTAGCAACGTAC
GCTAGCTGCATCTCGTTTGGCTGCAACGGCTTGCCGTAACTCTGTAATAACTCAATATCTTTCATCACCTGGGCATTGCACAACATCACGACACAATTTC
AGCCATCAGAACAGTGGTGTAAGCAAGCACCACCAGAAAGGACTCTGCAGTCCATACCTTGACGAGTGTGTGGAAGAGCTGCACATGCTCGTGTCGGCAC
TTCTCGAGCTTCTCTTCTGTTGCGCGGGTCGCCTTCTCCATTTCCTTCAGCTGGCCGCGCAGGTCATCCGTGTAGTTGTTGTACTTGTCCGCGTACTCTT
GCTGCACTTGGATGCGCTTGAGCAAGTCCTTGAAGCCGATCACCGGCGCTGGCGCAAAGTGCAGCGGGTCCGGGTTGTCCAGTTCGGCTTGATTCCATTG
TCGCTCACTGATGTGCGCTGGACGCGTGTATAAGTGGCGCTGCGTTGGATCCACCGCGTTATACAGCAGGAACTTGAAACGAGACTGCGCCGGGTCCTGG
TACGCGTACTTGACCGAGTTCAGCTGCGCGACAGCGGCGTCCGCACCGCAGATGATCGGCGCTGGGGTGTTCACTGGAGCAGGCGCTGTACCAAACGTGG
ATCTACCAGCAGTGCCAAACGCCGATGGGGTTGCAGCAGTAGAACCAAAGCCACCACCAAAGCTGCTTGTAGTTCCAAATCCTGTTGAGCCAGTCGTGGC
AGTGGTGCCGAAGCCAAAGCCAGAGCTGCCAGCCGCTGGCTGCGCCGCCGAAGTGGTCGTGCCAAAGCCACCAAATGAAGAGCCCGTCGTAGTTCCAGTC
GTATTCCCGAATCCGAACCCGCTGCCAGTCGTCATTCCTGTCTTCTGCCCAAAAAGCGGTGGCTTCGCTGTCTGGCTCGTCGCGCCAAAGAGCGAGGATC
CACCCGTAGTGGTCGATCCAAAGCCTCCGCCAAAGCCACCGCCAGTCGCTGGAGCCGCAGCGCCACCGGTCGAAGGCGTCGATCCAAAGCCAAACGAAGA
TCCGCCCGTAGCCGCTGGTGCTGCAGGCGTGCTCCCAAACCCACCACCAAACGACGACGCGCCGCCCGCCGCTGGTGCTGCTGCAGGCGTCGTGCCAAAG
CTGAATGACGAGCCGCCGCTACCCGCTGTCGGTGCTGGCGTCGACCCAAAGTTGAAGCCGCTGCCTCCTGTGGCTGCTGGCGCAGCGACCGTGTTTCCGA
AGTTGAATCCGGAGGAAGAAGCCACCGGCGCGGCTGCTGGTGTGCCTCCAAAAGTAAAACTCATGTTCGCGTTTGGTTTCTGGGAACAAGACGCTAGGCG
GGCTGTTCTGTTGCTCTGTACAATATTAGCACACACATGCACATCACCACAGCATTCATTAGTTGGCGAAGAAATACTGGAGACGCATACACTGGAGCTC
ATATTCATCCACACACCCACACACGTTGGCGATACGTCGTCCGTCTTGATGGCTCCCTGAGCTCAGCTTCCGATTGCTTGCCGTTGTTGTTGGCGTTGTT
TGTTGGCCTTCGCGCCAAACAAAAAGCTGGTTTAGGGAAACCTCTATCTATCCATACTGCTTGTTTTGCTGTTTAAAAAAATACCTCTATTTTTGAATTC
GGCGAGTTTACCGGTATACGAGGAAGAAATTATACAGAAAAGAACAAACATCCTCTTTTAATTGTATCCTTACCTGAGTGATGGTCTCTTCTGGCCAATC
AGATCAAAGCATTTTGTTCTATGTCGGTACCGATTTACCTAGCTGCCAGATTCCAAACACTTCTTCTTTGCTCCTATGTAGCTTCTACAAACCTCCGTCT
TTCTAATCCATTATCTACCCTCGAGTTTTTGATTTATTATATAACCTCGAATAACCTTGCTCAAAAGGAAGCCTCGCCTACCATCATTCATCAAATCGCA
CTTTTTAAATTACATACAGTACGTGAAAACACTCGTTAAGGTGCGAAATTTCCATAGATATGGCTTCGTGTGTGTTGAGTTTGGCTCTGATTGAATTATC
GAGTCGATCTTGAAGAAGGAACACGAGAGCGAGCGAGAGAGCGAGGACGACAAAAGACGAGAAGAAGGCGAATGGGGACGGCGGTGGACGATCCACACAA
GCTCAAGGCGCCTCCGCAGCAGCAGCAGCAGAGCAGCAGGATGGAGCAGAAGATGGCGGTCGCTGCGTCACCGTCATTCTCATCGTCATCGTCATCGTCA
GCCTCTATTGTGGTGTCGTCTGCTTCTGCTGCTGCTGGAGGACGCGTCGCGAGATGGCGGGTTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACT
TGCAGCTGAAAGTACTGCGCAGTAGCGAGACACACCCTCTGAGCAGCGTGAGTGCGCATAACCCAAGCGGCAGTAATCACGAGCCTGGTCGTGAAGAGAA
GCGATCGACTGCGGTGATGAGCAAGAAGGAGTCGTCTGACGATGTACGCGAACACGATCAAGACGCGAGTGTCCCTGCTCTGGAGCGTCGACTGTCCAGA
GAGAGTAGTGAGAAGTCCATGAAGGCGGCGCAAAAGCAGGAGTTGGTGGTACTTCAGGACGGTGACATCGATCCGCTCGGCGTCCTCTCTGCTGGAGTTT
CCGAGAACGCCACCAGCAGTGGTGTGCTTTCTCACTCAAAATCCTCCAACAAAAGCGCTGCATCTTCTTCACATCTGGACAGAAAGATGTCGTCTATGTC
GATTCACGAAGCGACAGGTGCGAGCAGCGGCAGTTCTGGGAAGAAGCAGGCGCCGCAGACCGTGAAGGAGTTGTGGAAGTCGCACAAAGATCGCGTCCTG
ACCAAGTTTGAGAACGTCACGTTCAAAATCAAAGCGGTGCGCACTGTTTTCTTTGCTAGGGTCCTTGTTTATGACTATAGCGTGTTCTAATGACTCGTCC
TTCTTGTTTCGTGTATCATGCGTGCCCCGCAGAATATGCTGGAAGCCCACGACCTAG