Description :
From Genome Similarity Track
Location :
Scaffold_285:26664- 31710
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_285-snap-gene-0.22Serine protease family S10
Pytir_DAOMBR486maker-pir_contig_285-fgenesh-gene-0.1Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_285-fgenesh-gene-0.2Serine protease family S10

Sequence
5046 bases(100 bases per row)
ATCAATCAGCACATAAAATGATGTATACCACACCAAAACAATCTTGGCTTTCAGCGTGGCATCACAATGGATGAATGATGGATGAATGGCTTCAAAATTG
AAATGGCAATCGATTCACGACCGACACTACGAATTGGTTGGATAGCAAGTAGTTCAGCCTCAGCAACCTCCCCTAGCGACCGTCTTGCCATATCTACACG
CACGCCCTAGAACGTCTCGTTACGCAGGAAGCGATTGATCATCTCCAAGGCGACCACCGGCTGGTCGAACGGCACCATGTGGCCCGAGTTGAACACCCGG
ATGAACGTGAACTGCGTCTCGAAACTGCGCACCGTTCCAGCAGCACTCGTCGTTGTCGAATCAACACCCTCTACGACGAGCAGTGGGCGCTCTTCCGCGT
CATTGAACTCCTTCTGGTGGTCCCAGTCGAGCGCCAGCGTCCACGCGTTGTTGCCGTACCAGTTGCACATGAGATCCGCGTCACCGGCGTACACCAGCAC
GCGGATACCTGCATCGTTCAGCAAATCCGCGACATAACCTTCGTAACCGCGCATGACGTCGACTGCAAAACCCATGCCGACCTTGGCGCTGCACTCTTCC
CATTTCTTCACATGCGCATCGCTCACATTCAAGTGCTTGCGCACAGCTTCCGAGTTCACGTACGCTGTCGCGTTGCTCAGGTCGTAGCAGTTCATCGAGT
CTTTCTCGTGGCACTCCATGCGGATGTCGTACTGGTTGCGATTCGAAGCCGCAAGCGGACCGAGGATGTTCAGCTGGCAGTACGCAAGCGCTTTGAGGCA
CACGGCCGAGTTGTCCTGGCAGTCCTCAAGCAATCTTGTGCACCTTGGCAGCGCTTTCTGCGCAACTTCCAGCTCAGACTCGCTCAACAGCGTGATATTG
TACGAGTTGTTGACCATATCGAGTGCATGCGCACTCTGGACCACGGGGTTCACGAGCCCATTGCCGATCGCGATGCCCTGCAGGTTGAGCACCACTACCG
TGGCGTTCGTCTTGTTCACAGTAGAAGCAGCTTCATTTTCCTGCCAGATGTAGTGTGCTGCAGCAGGTACGTAGTGGCCCGCATAGCTCTCGCCCGTGAT
AAACAGCGGACGCCCACTGAGCTCCGGGTGTTTCTCCATGAATCCCTGGAGAAACCAGTAGATGTTCTTCTGGACGTCGTCTTCGTCGTGGTCCAGGTCC
TCGTCCGGGCCGTATGAAAAGCCCACGTCCGTGGGCTGGTCCAGCCAGATCACGTTCGCCTCGTTCGTCCNNNNNNNNNNTGAGTACGGATTGAGCGTCG
TCGTCGTGTTCGTGAGTACTTTGCAGGGACCGTTCTCGCCCAAGAGTGCGATGAGACTCGAGCATCCGGGCCCCCCCGTGAGCCAGAGCACAAGCGGGTC
CTTTGACGGGTCGCGGCGCGACTCAAAGTACCAGTAGAAGTAGTGGTCGTCCTTCTTGTTTGGCAGCTTGATGTACCCGGCGTCCTGCTTGGTGTCGCCA
CAGAAGAGTGATTCGTTGCTTATAGGAACAGCAGCGGGTGGTGGGGCGACAATCGTGCGAGGCTCACCAGTTGTACTCGCAGGCGCAGGGATTTCAACCA
CCGCAGTCGGTGCTTCAGTAGCTGATGGTGCTGGCGTCTCGGAGACGACAGGAGATGGCGGCGCTGGCGTGCTCTTCGTGGTTGCGTTCGTACTGCTGCT
GGAGAGCGCCCACCCACCGATCACCGAGACAACCAGCAGCACGCCCACGACGATCGCGATGCGCTTGCGGCGCTGCGCCTGCGCGGCATTCACGGCGGCG
GCGGTCTGCAAATCCGGTCGCAGCGGCGTGCGTTCGGTCGCCATGTTGGATCCTGTGACTTGCGCTCTTGAAGGCGAGATCCATACTGAGCCAACAGAAA
CCAACCCCCCAATGAAGCGAATCTAGAAAAATATGAAGCCGCCTCATATAAATCAGGCGAAGAGAGACCTGTCGAAACTCGGCAGGACAGAAAATATCGA
AGCCAATCAAGGCAAATCAAGGATTCGAAACAAGGGAGACGCAAAACCCCCATTCCATTCTATTCTATTATTCACAATCAACACGTCGTGCGTTTTGCAT
TTTGCATTTTATATTTTGTGCATGACGCGGTTGCAGTTGGAGCGCCACATGACAGGTGAGTGATTTTTAGTTATCCGAATGCTACAGTTGGTCATTCCAA
CTGTCAATACCAATAAACACCAACACATCTGTTGGCACTTCGGAGTACTCGCCGACAAAAGTGAATTTTCTTCTTCATTCAACCTCATCAGTTACCATCA
GCGAGCCACCATTTCTCAATTTCCAAGCTCAGTTGTCCAGAGAAGCGAGGAGGGATCATGAGCAAGCAGATGAAAGCAGAGTCCCGCCACCACCATCCGA
TGGAGCGGCCGGAGGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGAGACAACGGCGACGAGCAGATTTTCCGGTTCGCGATGGAGCTTG
GCAGCAACGCCGAGCAGGAGCCGCCGATCTTCTTCCATTGGCAGCACGCGAGCGAGTTTGTCGAGGCGATCCGGACACTTTCAAAGAGTCTAGGAGAACC
GCAAGAGGTGCCCCCGTTCCCCATTCCAGAACCGTTGACGGAAAAGAGTTTCAAAGTGGCTGTGATGAAGCACTTGTGGTGCGAGAATGAGGACATCCCG
GCCGAGCCCGTGGAGACCAGCATCCTGCCGTACACTGTCGACTATCTAGGCCAGTGCGCAGCGAAAATGGTGGAGCTGCGCCACCACCCGTGGATTCAGC
AGGTGATCCGCCACGGCGGCCAGCGGATCCTGCCGCTTGCTGTGCCGTACATCGCTCGTCCGCAAACGGAGATCGTGAAGCGCTTCCTGAGGACGCAGAC
GAAGTCGCTCTGGAGCTGAGCGAGCGAATGGCAGTTCGGTTTCAAGGCTGTGAGTTGAAATCCAGATTCATAACCCTCTCTACATGAGTAATACTACACG
GTTGCACACCTACTTTTCTGCCGTAGACGTGAAGATCAACGATGGCATCCAGAAGCCCACAGAGTTTAGTTTAGGGCCGATGCGTTTTCGCGACCTCTGA
TCAGTCAATTCATTCCCCACAGCGATTTGGTGGACTGCTGGAAAGAGCTGGCAGCATGCCCACGTTGGATACAGCTTCCGTGATCTCGACAAGAGTACTC
GGTAGCTCATCTGGTGGCTCCCAGTTGCTTAGGATTGCCAGCCAGCAAAACTTTGGAAGGAATGATGTGGCACACACCAGTCCACTCTGCTTCACAGTCT
GAGTAGGCTGTTTCGCGGTGATGGAGCCAAATAGTGCCGCTCAAAACCCCTCCTTCTCTCTGCCTGCGTCCACTTCACTTCGGACAGGAGTGCAGCGCCT
CCGCCCCCTCCTGCCCACGAAGAAGAAGAGGAACCGCTAGCCACCGTGCAGCCATTTGCCTTCGACACCACGTCACGGTGGGGACGAAGCGTGAGTTGAG
TTGAGTGATTGACGCAGAGAACGATAGCTGACCGAACGCTGTCTTTCTTGCCCACACTCGACAGACACCAGCACAAGAGCACGTAGACTCACTGCCGTTC
CAAAGAGAAGCAACACTATCAGCAGCAAGCCACTCTCACATAAGACCACCAACACGACCATGGCAGTGAGCGAAGGCACGCCGCTCCTGCATGATGGAAC
GGTGCCTCCAAGACACCACCGCCGTGTCTTCAAGATCGTGCTTGGGCTCGTGCTGATCGTCGGCCTCGTGCTGATCCTCCTCGCTGCTGCTCTCCGAAAG
CTGGCTGGCCCCGCTGTCGCGTCCGCCACCACTGACAACGGCTACATCTGCGGCATCACGAAAAACGAAGCTGGGTACATCAAGCTCGCGAACAAGAAGG
ACGACCACTACTTCTACTGGTTCTTCGAGTCGGAGACTAGTCCAAGTAAGGACCCGCTGATGGTGTGGCTCACTGGTGGACCTGGTGCCTCTAGTCTGTA
TGCACTGCTGGCTGAGAACGGACCATGCACTGTGCAACCGGACCTGACTACCAAGAACAACCCATACGCGTGGAACAACCAGGCGAATGTGATCTGGCTC
GACCAGCCGACCGACGTCGGCTTCTCGTATGGCGCACCAGAGGACAAGGACTACAATGGCACGAACGTGGGCGAGAACCTGTACTGGTTCCTGCAGGGCT
TTATTGACAAGCACCCAGAGTTCGACAACCGCGAGTTTTACCTTTTTGGAGAGAGCTACGGAGGTCACTACGTCCCCGATGGCGCGCACTATATCTGGGA
GCAGAATAAGCTGGGAGACAACCAGCCAGGCTCAAAAAAGATCAACCTGCAGGGCATCGCGATCGGCAACGGATGGGTGGACCCCGAGACGCAGGTACGT
ATGTAGTAGGATGCCTCGTATTGTCGGTATCTTGTACTCACAACTGTGAAATGGTTCCTGTAGTACTTGTACGCAGACGCGATGGCTGACAACGCGTACA
ACATCACGTTCCTGACGGACGCGCAGATTGGTCGGATGAAAAAGGACAACCTGGTCTGCGTGGAACTGGACCTCAAGTGCCGAGCCAACCCTTTGGACGG
AACCGCGTGTATGGACGAAGAGGAATTTTCCTACGAGACGCACATCCTGCCGTTCCTCGCCGCCGGGAGGAACCCGTACGACATTCGCGAGGAGTGCGAC
ACTGAAACAGATCCGCTCTGTGATGGGAACGACTCTCGCTTGGTCGATTTCTTGAACTCCGACAAGGCCCGTCAGTACCTCAACGTCAACGTCGGCCCTC
ACAAGGTCTGGAAGGAGGTCAACGGCCAAGTCAATCACGATTTCCTCGCCTCGGGGGACAACGCGCAGCCATCGCAGCTGCTCGTCGCGGATCTATTGAA
CGACGGCGTCCGGGTGCTCATCTACAATGGCGACGCCGACCTCATGTGTAACTGGCAGAGCAGTGACGCGTGGACCAAGGCGCTCGAGTGGAAGGGCAAG
CAGGGCTTCAACTCTGTGGAAGAGCGCCACTTCTTCGCCGATGACG