Description :
From Genome Similarity Track
Location :
Scaffold_104:266634- 269977
Transcript NameFunction/comments
Physo_141890hypothetical protein

Sequence
3343 bases(100 bases per row)
CCCCATATGCTGACTAAGGTCTCGAATCTAGCAAACTCGATGGCGATCCAATGGGTCGTGATATTTCTTTGAGGTCGTACGAAGTCCTGTAAGTACGTAA
TGGACTACTAGCCAATTGGTTTGATACATGTACGTATCTGCAGCAGCTCTGTAATGAAACCGCAAAACGTGCCTAGCTTAGACTTCGTTGCGACGCGTTC
CGCTACTTGAGTTGCGTTGCAGTTTGACACTTGTGCTGCAACGTCCCGGTCGCTTGGACAGCAATTGGCTATCGACGGTACTTCTTACGGTACTGCGCTA
AGTCCAACTCTTTGACAGGTTTGTGGCCCCAAATGATAAAGTGCTGATGGATTTGTGGTCCCTTTTGATAAAGATCCTCTACGATGTTCGTGTTGCTTCG
TGTGGCATCGGCTCGGATGAATTCATACAAGTTTATGACCTATTGCTTGCACGGAGCCCGTGATGTTGAGACTAACGAGCGAAACTTCCCTCGAATCGAG
CTATAGCTTACGAATCTCTCGGACTTGGCGCATCGGTGCATTAAACGAACCCTGCATCAAATTTCCGAGAGGTTCCCCAAGCCGTCCGTGCCGATAGGAA
TGACGTTGCTGCTTGACCCACGAACAAAATCGTCCGCCAAAACTTTTCTCCAAGTTCCAGACACTGCTGAGGCGGTGACTACCGATATTTTGGAGGAAAC
AAAACGTCTGATGCGCATTGAGCACCACCGTGTGTTCTACAAGGGGCTGTACGCAAAGGACGACCAAGGAGGTAGCAAAGCAGCTTCTGCCACGAGTTCA
CCGCCTACAGAGTGCTGCAGCAGTTCTGACAACGAAGCTGACTTGGTTTGCGGTGAAGATGTTTCAGAACCGGCCGGGGATAAATCAGCAGAGGCAACGC
TGAATTCCCAGGCGATGCACTATTGGACGAGTGGCTAAACTTCCGGATTGAGTGGTCTGACGTAGCGAGAACGCAGTATCCAGCCAAAGAAGAGTGCGAG
AAGGTTTTATCTAAGCTGACCATGCGCGATAGAAAACGCAATGTGTATGTGTAGAATGTTGAGCAGCTTTGCGGGAACATCGACGTGTGCCGTTGGTTTG
CGGAGGTTGGTGAAAAAAATATCCGTCAATTGCGAAGCTTGCACGCGTCTGGCGGGGACGTGGGTGTTCGACGGCGTTCCAAGAACGTGTGTTCTCAACT
GGTTCTTTCGTGATGAGTCCTCTGAGGACGAGGACCGACAACGAGCGTGCGCAGCGGCAGCTCATACTGCGCTACAACCGGCTCGAGATAAGGCGTATGG
AGGCCAGTAAGCACCAGATATGGTAGGCCGCTTTTAGGCATATTAGTAGTCATATTAGTAGTCATATTAGTAGTCATATTAGTACCACCGATACCTCACT
ACTAAACGATATAGCATTCTACTATTGCCAGAATTTGGATAGTAATAGTAGTATGACTACTAGCCAAAATTCCCACTACTACCAAACCCTGCATGTACGT
AGGAGTTGTATGCGATGCTAACTACTGTGTGTTTCTACATGCAAATGAAAACATAGTTTTTATCTATCTCTTCTGGTGGTTGATGAAGCGGAGGCAAAAC
AGCGCCATCAGCCGTAAGACGACAATGAACAGGAGGACGATGCCGAAGTTGCGCCAGATCTCGTCGTGCTTGTACTCGAACGTGGACTCGACGTACTCCT
TGATCGTGGTATGGTCGATGTTGGTCGGCGGGTTGGTCATCGGCTGGCAGCCGAGACTACTGCCAACGTTCACGTACTGCTTCGTCTCAGTGTCGTAGCT
CAGTAGCTCGTCACAGTCGCTGAACACGAGAGAAACTAACACACTGATTGAGTATCGCTGAGGTGTGATCGTGTAAAGCCATCGGTACCCGGCTGGGATA
TCGCTCGCAGGCGGGTTGAAGCCGTAGAAGAGGATCGTAATGGAGTAAATCATCACGCCCACCAGCGCCGCCACGTCGATGCTGGACAGCGAGTGCTGCA
ATACTTTTGCATCGATCACTGCAAACCGTGGTGTTGGCATGTGCGAGCGAAGCCGAAGGTCGCTCGAAGGTCGCATGGCTGAAATCTCAACTAGCTGTAA
CCGTAAGACTTATCACAAAGATATTCCTCCCTTGGCGGTGACCATGGAATGCGATGCGTTCCGCATGGAGAGGATGCTGAACTTTACAGGAGCTAGCGAG
GGCATGCGCTTCGGCTTCATCAAGTGCCGCTTGGACAAGGCCTTCGCGCTCGAGCTCCAGTCGGAAGACGAGTACTTTAACGCGCTAATATCGCTCTCGG
AGTACTCGTTTGGGGCGTTCAAAAAGGACGCGAGCAACCCCATCCCGGGCACTGACATGAACAAGAGCGATGGATCCTTCAATAACCTGTTCCACTACGA
CTACTCCAACAACGTTGACTACACCTTCATCTATGACTGCCTGGCCAACCCGCTGATCCGAACGCCAGTCTACCAGCAGTACTGCGGCAAGCACAGGGAT
GAGCTTAATGGGATGTCTGGAGCGCTACCGAGTGGTCACACGCAACCTCATCCCGCTGATGAAAACGCTGCGCAAAGATTTGTGCAGCATCTACTTCGTG
GACGTTCTGTACGACCTCATCCGCTTCGAGAGCCGCGATCTGTACGCCTTCATCGCCTATGTGGTCAACCAGTTCAGAGATGGTTCCAGCTTCAAAAGCT
TCATCACCGACTTCGGAAAGAAGAGAGCGCGTCAGCTGCTGAAAACCATGAACCGCTCATTCCGCCGCATTGACTTCAAGTTTGTTCTGAAGAAGTATAT
GCCGTTGCTCTACACGGTATATGCTTACTGCGCCGACGCGCGAGTGGACTGTCTGGACCGTGTGTACGACTACATGCTGAATGAGGGCCTCTCCGTCTTC
AAGACGGTACCAAGCAAGCAGGTAGTGGTGGGCTACAAGGTGAACGATCAGTACCGCATCGATGTCCTCGAAACAAGCGCAGTCCTGGATTTTGTGGGGG
ATCGCCAGTTTCAAATTGCTTCGCACACGCTGCTTGAGAGTCTGAACTTCGGGTTTCACGATGCCCGACTCAAAGCGTACCAGGACATTAGCAGCATGGA
TCGTCGAATTGGTGGTCAGTTGCGCAAAATGTACGCCAGCTTCAGCTTCAACGGACGCTCAGTTTTCAGCGGCCGAATCATCTGCTCCGAAGATGCGATC
GTCGTGGGGTGCTTGAAGAAGAGTGTGAACACTTTCCAGAATTTCCGCTTGGATATTCATATTGAGTCAATTATCCCCAGCAGCAGCAGTGCCGACTCGA
TGCGATTCATCAAGCACTCGAAATGGAGCTTTGAAGACAATGA