Description :
From Genome Similarity Track
Location :
Scaffold_433:2666- 7676
Transcript NameFunction/comments
Phyke_g9418hypothetical protein PHYSODRAFT_286359
Phyke_g9419Major Facilitator Superfamily (MFS)

Sequence
5010 bases(100 bases per row)
TCAAAATGGCATTAGTCCTACATCTCCTCACTGTAAATAAAAGAGAGCTGACGGACGGACAACGCACCACCAACGAAAAACCAAAGCACTAACTCGAGCG
TGGGCCTCCAGCAACCGTCCCGCGTCGCCTCTGGTCTCGCCAATCCTCACCTCGTTAAACTGGTTAGGACAGTCACTGGACTCTTCCACCCGATGACTCT
TGACCTTCCTGCCGTCGCTGCATGCCACACCCACCCACTGCGCAGCTGCCCAAGCCAATTATACACCATATGAATCATGCAGAGCCTCCCCTGCTGCCAT
CGGCCGAAGAGTCTCTTCGCCGCGAGTAAGAGAGCTAAACCCACGCCTTGAGTCTCGACCAACTACCAGATCCCCGGTCATCAAATCATCAAACACATCC
CAGCACGCCTCGCCAAATAGTCAAAACACTTTCTCTTCCACTAGGCGAAGGAGACGCACGCATCGCGCTTGTATTGATTCCCGACGGTTTGATAGCAACA
AAGGCCAGCAACGCCACTCGACTTgtcagcttccagctcttcatcctccgGTTCCTCTCTTCCCCCAGTTCTCCCCTCCTCCCTCCTGTTGTcgccgtcg
ccatcgttccaccatcaccattgtcatctcttcatccaaCACTTCGGCGACAGCATTACGACTTCCACTTGGTCGACACCCTCTTACTTGGTAGCCTCCG
CTTGACGCAGGTGTGCTGAGCACAGACCTTTGCGTCGGCATGGCTTACTGCAGGCCTCCATCGTGCAGCGCTTGCCGCCGCCGTGGGTGGCGCACAGACC
TCCGCCGCGGTCGTTGCGCATGCAGCCTGGCACCTCGCAAAGACGCGAGCCACCGTGCAGCGCACAGTAGTCACCGCGCTGGGTTCCCTTGTCACACCCG
TCGAACATGCAGcgcttgccaccaccgtgcgAGCGGCAGAAACCGCCACCCTGCGAACTGCGCGAGCAGCCGTTGAACTGGCAACGCGGGCCACCACCGT
GGGCCTTGCACAAAAAGTTTGACTGCGCCGCCTTGTCGCAACCCTCGTGGCTGCAACGCTTGCCGCCACCGTGACGGATGCACAGGTTGCCTCCCTGGGA
GCTCTTGTCACAGCCCTCCACGGCGCAacgacgaccaccaccgTGGGAGATGCACAGACCGTTCGAGCGCGAACGCTTGTAGCATCCCTCGCTCTTGCAC
AGCCGACGACTCTTCATCTCACCAGCCTTCACCTTGGTCTCAATGTGGGTTTCCGGCAGACGAGGGGTCATCATGAGTTCCGTGTCAGTCAGTCCCTCCA
GAGAGTCCATCAAACCCTCAATGGGGGTCCCCGCCAGCACGTTCAAATTCAAAATGCCgtcgtccacttccaccgccttcttcttgtcctccgGGGCGTC
GACCAAAAAACTGTACAGAATGGACATCTCCGTACCGTCAAATCCATCGTCCAAGTTCACAAGGTTCGGTTTGTCCTTGTCCAAGTTCTCCAGTTCACTG
GGCATAGAGAAGTCCAGTaattcctccagctcctgaGTCTCAAAGTCTGGCTGCGTAATAGCATTCGACTCCGGCTTGACCTCCGACTCGAGGGGGGCGG
TGACGAACTGCTCCGTCGACATACTGAGGCCCATCAAATCCGTGTTGGGGGCGGCAGTCCATGGCATCGTAGGCATGTTGGTGGCCTTCGGGAACGACAC
GAATGGAAGCGCCGGGGGCGGCGCCGCCATGCTAAGCATGTTCATGCCATCCGCAGTGAAGGGCAGGCCCTCGGCGGTGGACCAAGCGGGCGCTTGGCCT
ATCTTGGCGTTCTGGCTCATCATGGCCTTGCTGGCTGTCGGTTGGTATCCCGCAAACAGCGCAACGGCTGCCGGGCCCATGGCGCCCAGAGAATCGCGTG
ACTCTATAGGCCGGCACATTCTCGGGCTGGTTCTTTCTCTCTTCGCTAAATCGCTGCTTTCCTGTGGTTAACACTGTTCGCTTCTCTCGTTTTCGAGCAC
TTTGCGTTTATGAGGGCGGTGCGACCCGTAGGACGGCTGGGTTTTCTTCCACGGAAAACGCCATGTTCAAATGGCCCTGCTATTTCGAATtagaagaaaa
tgaagaacGCCCATTGGCTCATAAACAGATTAGTATTGACCTGATTGTGTGAGGAACACGGATTGAATAAATAGAGAGCCAGTCGTACAGCTGGTAGGGT
AAGGACAACACCTGACCTCACTTTCACTCGATTTTTGTAAGCGATCTGGAGCGACAGGGGGATCAGGAAAGGGGAACGCATAGAAACGGACCACGCCAGA
TTGTTACGCTTTTGTTGGGTACCGATGTCCCATTTTGGACTAAAATTCGCCGGAATTTGAGCAAGTATGCAAAGTGATCGCCCCAGAGTGATCAGCTTCT
CAAGCGATGAGCAGCGCTTGTTGGAGTTGCTGACTGTGCAATAAATTCCCGCATTGCATGAAGTTGGGGACGCGTTTCACCGACCAagcttcgttttctt
ttAGTGCATACGCAAGCGTTGGTCTAAACGGCAGTTTTTAACATGAAAGCAGAAAAAGCCGGCCTGCATTCTGAGCAGCGGTTTCGACAACGGCATTGTC
GTCAAGCACTAACGTCAGTGCTCTTGCGTTCCTGGACGAATGCCTTCAAGCAGTAGGAACAACGCAGCCATTGAACAGATGCAGGCGTAGTCGCTCGAGA
CGCAAGTTGCTAATCAAATTCGTGTTAACAGGATAGTTCCATTGCAATAAGAATTTAGGTAACAATAAATGTGGACGAATGCGCTAAATGACGGGACAAG
ATCATGAAAATACGGCGAGATACACCGCGATGACGACATCTGTAATGCAGATATTAAAACCAAAGGTGTGATTGACGACACGAAGACAGATCACCCGCGG
GGTAGACAGAATTCCACTTCGAAGCATGGAATGGTTAAAAATATACCGTGAGGCCATATCGCGAACCGTCTGTATGCCCACCGGCACGCCACGCCAAACC
ACCGGCCTCAAACCTACGGTGGGTCTCATCTCCTACGACAATACTGGTAACCCTCACCTGCGCCAGGACGTTAGTGATGATCTGactgacaaccgtctag
gacggCACTAGAACAGCCTTTTTGCGGTagtttcgttgagacctgcGATAAGTTGGCAGACGTGGTAGACCGCGCAGTGAGAGTtgcaacatcagcaaga
tgttccgcgagcgcaccacaccatcacaGCACTTACGACGCTGATATTACTGCGACGGGCCGTGGGCGCCTCCTGCTGGGACACCCgtaatgcacacgac
tggtgcggtactcgtcctcagGCTCCACGCGACAGTACTTCTGGAAGTCTctctctccagacgctttgACCGTCAACCAAGGcatttcttgatgaatcca
cCGTAGTctttgcagctccagtcacCAAAGCCCACAATCGTCCGAGATGCGTCTCGGCCCTCAACGAAGAGCCCACAGAGCTGATGTagtttcttgcgcg
cttGCGAATAGCGTCTAAACCTCAGATCTCTTAACCTCTTCCGAATTGAGAAGCCGAGCAGCATATCGAACCGTGGAATCATGTACGCGACGTACGTCTG
CAACTTGGCGAGCGAGCAGGTCTTTTTAGTCTGCActccatgtactgcttcgGTCACCGctggctctgctgtgtcgtaCCAGTGCCGAATTGTCTTGTTA
CTTGTGTAACTAGCGTCATGGTAGAACTCCTTGCTTGAACAGTGAATAgtggtgtcgtcggagcAGGTTAGATAGCAACAGGGTCTCTGAAATCCTGGGT
GATGGTTGCCCTTGGGTCGCTGAAGTCACCACCGGAAACCGCTGTCAGACGTTGTTGGACGAAAGATCTATCCAGAAGAGGGAGCCCGAATCCTAGGTTG
CTCGAGCGGATCGCATGCAGGTTGACGAGTATGTAGACCTTTGCCACTATCTTGTTCATGTCGTTGAGGACGTCCTCCCACGGCAATGCCAGCCCCGCGT
CCGTGCAAGGCGTTTCTAGCTTCAATTTCACCGAAGCGTACCCACGCATAGCGCTGCTCTCGGCTTAGTTTTTTGTCACTGATCCCTTAGATGTTCGCcg
cttcttcgtcgttggCTGTTCTTGGCGTACCAGGGCGCGGCGCCGCGCCGCGCTTGGAGCCTGCACCACGTCGACTTCGAGGAGGGGCCGGGAGCACGGC
GCCTCCACCTGGATTCCGAGGTCTTACCATGTCCAATGCAAAGGCGAAGTGAGCATAGTAGATCACTCGCTGTGAGGCCGAGGCTAATGGGTGAGCGCCC
AAGGCACCTGACTTGTTCTCCATTCTTTCACATGCGCAAGCTCAATGCTCTAAAGATCTGGCGTCCATGACTTTTATGGCGAGGAAGTGTCTGCCTGACT
GCAAAATAGTTTATTCAATAAGCGTTGCGCGCCCACGACGGCTCATGCACATGGAtgttgaagaagttgatccaCGAAGGGCCGCATCTTCGGGCTAATA
TCCAGCATAAATGCCACTAAAGCGAATAGTGGCCTTTATGCAGGAGCTAATTCGTGCATACTATCCGCCTAATTCTTCGCAAAGGAGGACCATCCATGAC
CACAGCATAAATACGCGGCGTTCGTGTTGTGTTGTCACATATTGGCGATGAGTGACCGAAACACGACGATATATCGGCTTATAGCGCCAAGAATTCCCAT
GCTTTCGGACTTAAACCGCATGCATTAGTTGGCGTGGAGACTCCATGCCAAAGAGAacaaacagcatttttaTCCTGGTTATGTAAATGAATCTTTCGTG
CAATTTTGGGCCTTCGGACAATTTTAACCCCTCCTATGCAACATTGAAGCAAaatgatgatggtgatgggTGGACAACCAAATAATGTGGTGCACATCAA
CTGATTTGCTACTGTAAAAGAAAGCTTCAAAGTAGTATCCAGAGGCTCACTCGCGACCGTAGGGAGTCTACCTACCGCTACTATGGAGGCTCACGTGGAC
GTCAccgaga