Description :
From Genome Similarity Track
Location :
Scaffold_1885:2666- 6343
Transcript NameFunction/comments
Phyta_totarag13813hypothetical protein
Phyta_totarag13814hypothetical protein

Sequence
3677 bases(100 bases per row)
ACCATTCCTCCTGATCTGTGGCCTCCTCGCAGATCCTTCACCCAACTACTCACAAAGTGACCAGCTCACTTCACGATCCTGCTGCCTTATTGCTCCTCGT
GCGACTGTATGGCCTCAAACCGGTTCCGGTTGGCCTGTTCGCGCAGGTAGTCGTGCAATACAGCTCCGCAGTTGAGATCGGCTTCATCCACCCATGTTGG
TTCAGAGTATCCCTTCCAGTGCACCAGAAATTCTCGTAGCGCTCACCCGTAGCGTGTTCGCCGTCCAGATCGCATTTCAGTGATGCGTTCGACCTCGTAC
TCGTCATCATCGAGCTCTGTTTCCCAGCTATCCTCAGGCAGTAGGACTTCATCAAAATTAAGgcgatcttgatcttggacagCTAGCCGAAGACGCGGAC
GGTCAGGGAAGTCTCGTACGGGCTTAAGCTTCGACACGTGGATCACGGGAATAGGTTGTACGTCGTGCCTGCGATCTCCAGTCGCACGGCGTgttcgtcg
atcttctcgaccACTCTGAATGCTCCGTGCCACATGTGAGCCAGCTTCCGTGCGTAGCCCTCCTTCACCCTGTCCAGGTATAACCAAACCTGGCTGCCGA
CTTCGATCTCGTGCGGACGCACGGACTCGTTATGGCGAGCGGCTCTGGTTTCGATAGCTTCACGCAGCTACTCGTTCACTTGCTCACGCGCCTGTTGGCA
ATGCTTCTGGATATGGTATCGTCACCTTCAAGGGTCGCGATATCGGCGCCTTGTCGATCCTAACGGGATCATCGCTTCCAGCGTTGATCTTGGGTCCCAT
CCATGCACCAGATAGAAAGGCGTATCGCCGCGCACTCGATCATGAGCCGTGTTGAGGGCAAACGTGAGGCGCTCTGCGTACTCGTCCCAATCCTTCTGAT
CGACGTCTGCGACGTACATCTTCAGTGCTCGCGTTAGCGTCTGCACCATCCGTTCAGCAGTACCGTTTGCTTGCGGCCGATACGCCGTAGTCGCTCGTTG
GCGTTGTTCGATGATCTTGTTGAACGATCTGAAAAAGTCAGACATGAAGCCTGGCTCTTGATCGTGCCGGATTGCTTCGCTTGCACCAAATCGTCGGGAG
ACGCACTCTTCGTAATTCTCCGCGATCGTTTGAGCAGTTCTTGATGCACTTGCCTTGGCGATCACGAAGCTGGTGAAGAGGTCGACCCAGATCAACAATT
CTGTGTTGCCCTTATAAGATCGGGGCAGCAACGGGATGTGGTCCATAGTGATGATCTGAAATGGGTACGTCGCTTGTAGGTTGCCCGGCGACTCACCTCG
AACAGTTGGTCTCCCCTTTTCAGTCTCGCAGTCTATGCACTGACCCACGTAACGTTGCACACCTTGATGCAGTCCTCTCCAGTGAAAATGTGCCTTGATC
CGCTGGTATGTCCTCCCGATTCCTTGATGTCCACCTTCCAGACTGCCATGGTAATGGTGTAGGAAGTCTTCTTACAGCGTCTCAGGAATCACCAGGCGAG
CAACGAGATCGCGGTCTTCATTCGATTACTTGGACGGCGGGCAGTAAAACAACAAGCCGGTCCCGTCGATCTCATAATCCACAGCGATCTTAGCGCAGGT
CTTTGCCTCTAATGAGGTAAGTTCCTGTACGTCCCCTCGCAAGTACTGCTTGAGATCGACGATCCacttttcttcatcttgtgcCATGCATATTCGCTCT
TCCCTCATTCTCTGAACAATCTCCTCCTGTAACACTTCTGGGCTGCGCCGCTTGCGCGACCTCGTCACGGCCGTGATTTTGGTCACAGCACTGTCAGATC
GTGGGATCAGCATCTCGTCAAGACGGTTAAGCGTCATCAGGTCTTGTAACTCTTCCTTTGACGTCACTACCATGCCTCCTTCACGCTGAAGAGCGGCACC
GGCGCGTCAATCTGCACTTTGGTTCCAGTCTCGCTTTATTTGAAGGAAATCGTGACTTGGCCACGATCTCAAGCGTTCCATAGCTAGTTGGCGTAGTAAT
TTTAACCCAGGTGCCTTGCACTCGATCTCGCCTCGCATCTGTCGGATGACCAAATTCGAGTCTCCGCAGATAATTAGCCGTCCCCTGTCCAGGTCGGCCA
GAAGATCGAAGCATAGGAGCAAACCATGATATTCCGCCTCGTTGACTGTCAAGTCGTCCCTGTACTGCGACGCAGCTGAAATCGCTTTCCATTCGGGTAA
GCTCCACACAATGGTGGCATAtgctcctccacctcgctTTGCTCGAGCTGATCCATCGAAGCTGACCACTAGCAACGTTTCATCCGCCTCCACCGTAGGT
GGCGGCATGGTAATTACCTGCCGGGGCTGCTTCCTGGGTGCTATTGAAACTAATATCGCGTCGATCTCTTCACATGGCGTGATGCTCGCAGCCACAACGC
CCAGGATCTCGTCCTCACTTTGTCGCATTTGACGATCTCCAGGGTCCAgctcgacagcaacacggTCCAGCGACCGAGTCGTCCTTGCAATCCTGATGAA
TGCACTAGCCATGCCAAGGGGGAGTGCCGAGTCAGCACCTTGACCGATATCGCCACTAGCTGCGTGTAGCAGATATTCAAAATCctgagcagcgcgagaa
ctTCCTTATCGACGATTCCGTAGTTGATCTCGTTAGGCTTGAGTGTCCGGCTAGTAAACGCCACCGGTTTATATACGCCCCCATGTTCTTGCATCAACGC
GGCCGCAATCGCCCACTTGCTCGCATATACCACCACAACCGGTCTTCGATCTGGAttgaagtgctgcaagatTGGCGCTGTCGCGATTTTATCCATCAGT
GCTGTGAAGGCTGTGACAGCTCGACTCCACTTTCCATTGTCATCTGTGGGTTGATCTTCGCCGTCCTTGGCTTGTCCAGACGCCGGGCCTAGTTTCGATC
TTCGCGCCATCTCATAGAAATCCGCCTCTCGGAGCTCGTACAGGACTGACGCGTAGATCGCGAAGTCCTCAATGAAGCGACTGTAATAGTTAAGACTCCC
CAAAaacgactgcatcgatctTAGCGTGGCTGGAAATGGCAGACCGGTCAGCGACAGCAGGTCCTTCAGGTGAGCTTCCAATCCGTCCGCNAATATAAGA
TCGACGACCTAGCACCGACGATTCCTTTCCTTCGCCAGGCACTCCCTCCTCGAATACGTCGGTCTGGTTGGCGTGATCTTGGCTGCTCGTGATCTTGGCT
GCTCGTGATCTTGAGGAACCCATACAACGCGTTGTCCACCAACCTCTGGTAAATCTGCGGCGCGTTCTTCAATCCAAACGGCATTCGATTCCATTCGAAT
AGCCCGAATGGGGTAATAAACGCCGAGNACGATCGGGGACGCCCATGGCGAAGTCGAGTGTCGGATGATCTCGGCTGACAGTAAACCCTAGATCAGCAGG
AACAACTTCTCGCGGAATTGCGGAGCGACCTTGCGGTCCCGTTGGGCTATTGGTCTTGCATTTATCACATCACTGTCACAGATCGCTCCCTTCACAGCAG
GTGGCAAGGCGTTCCCCTTCCCAATTAGAAGGTGTCAGTGACGCCAGATGATCTTCACTAGTCGATCGATCTCTTCCGGCGTACTGTCCTCAGGGTTTCC
CACCTGAATATCCTCGACCTTGACTTCTtccgtcgtcgacgtgaTCTCCGGCAATACCGCCATGTGACCCTCGAGAT