Description :
From Genome Similarity Track
Location :
Scaffold_89:266590- 271094
Transcript NameFunction/comments
Hyaar_Emoy2808856autophagyrelated protein putative
Hyaar_Emoy2808857hypothetical protein

Sequence
4504 bases(100 bases per row)
TTTCTGTCGTGACCATGAGCTCGTTCAAGAAGGAGCACCCGTTCGGTACGTGGGTAGCTTCTCCTCAGCTTGGTACTGAGTGTGGAAGGACAGAGCGCTA
ACGATGTTTGGGGGTTCCAGAGAAGCGCCAGGCTGAAGCGCAGCGCATTCGCTCCAAGTATCCCGACCGCATTCCAGTGCGTGGCTATTTCCTGTGTATC
TAGAGATGGAACGAGCGGAGAGATCCTTGTTGTTGGACTGGCTCTCTTACATTGCTGTGGGTGGGATATGTGTCTGTGGTCTCTATCGCTGTGTCTTTTG
TAGGTTATTTGTGAGAAAGCGGATCGCAGTGACATCCCGGACATTGACAAGAAGAAGTACTTGGTGCCGGCCGATCTGACTGTCGGTCAGTTCGTGTACG
TGATCCGGAAACGCATTAAATTGAGCCCGGAGAAGGCCATTTTCATCTTCATTAACAACGTGCTCCCGCCCACCGGTACGAACTGGATACAGGTGTCTGT
CTCTTGTGTGTTTACTGTAGTTTACTTTACTCAAGTCGAAATGTGTGCAACTTGAATCGTACAGCTGCGTTGATGTCGAACATTTACGAAGAGCAGAAAG
ACGTGGACGGCTTTCTCTACATCACCTACAGCGGCGAAAACACTTTTGGCCAATAGGTCGAACGTTGTGTCGATGTACGGGAACTGGATTCTTGCGGGCC
GTCCGTCGTTGCTGTCGTGAGTTGTGAAACCTGTTGCTCTCTTATGACAGGAGGTGCAGCGTTCATGCAGCTATAGGTATCGATCAAGACGTCGTCTCGA
AGGTGGATGGAAAAAGATGAGGTGGGCGTGGATGAAAGCTGATCGGCCGGCGATGCTTGCTCCGAACAGCTTTGGCGTGTGCGATTCATTCTTTTATGCT
GGCGATGTGGATATTTTAGGACACAAAACAGAGAAAAATGCATGACCTTCTATTCACTCGCCTATTTTGTTCATGCTCCCATTGTTACTGTCGTATCACG
CTGTTAAATGATGGTGTTCCTCACCACGTTGGAACTGCAGCATCTGCAGACCCTGACCAACGACAACAACGTCGTCCGCTGTGCCAGCCGGAGCTTGCCG
AACTGCGAGGTGTGCAATGTCGGCGCACTCCGAGAACGCGGCACCTTGCCACTCAAGCTCAAACCCGTTTTCGTTGCGCTGAATATTCCACTTGCTCACT
CGTTGGTCGTAGCCGGCTGCAAAAATGACTTGAGCATTCACACACGAAACAGTTTTTATAGCTGAACCGCTAGCATTTACCACCCGGGTTTTGGAAAGTA
GTTGGCACGATGGAAAGCGCAGTTGATGTAAGTTTAAATTCTGGTCATCTCCACCACTGACGATTATTACATCCAGGCTTCCCTCTTCGGCACTTCTTGC
GCAGGAGACGAGATCTATGCAGTTTGTGCCCATATCGTGTGCCAAGTAGTTACCACTTGGACGTAACTCACTTATCAGCGGCACTAGCTTTTCACGAAGC
TGTTCCACGTCAGAATGGGATCGAACAAGCAACGACCCAATCTTCTTCAGCAGCAACGTCAAATCCCACAGCGTCACCAAACCATCCGTGGAGCCAACTG
CTAGCCCTGCAATCATCGCGTCGGCTTCACCTTCCTGAAACCCTACGCAGGACAAGATCGGTTTTCTAGAGGCTGAACGGCAGTCACCGAGCTCGAAAAG
TCCAGCGTTATTCACGTCTAGCAGAAGCAGTTGAGTGGACCCTTCGGAGTTGCAAGCCGTCACAAGTCGGTAATTTTCTGAGATGCGAGGAATCGGGAAC
GTAGTAAGCCCAAGAATACGATGGTCCTGCGCTGCTCCTGTACGTTCCTGGCCACAAATATGACGAAGTGCATTATCGTCACCAGAAACTAGCCATACAT
TTAGGCGCTGCTTGCCTCCCCCCGAGAGCACGATGTGTTCCTCAACGCCGTCAAATTTTTTGCGAGGATACGTCGTGAGCGCCCTCACAGTTGTGGTGTG
GGCAATCCCGGAAGCTACGCCGCACCAGCGCAAGTGTTCGTGCTTCTCGTGGTCATGTTGAGTGCGGCGGCGACGATGCAGCATTAAGCTGTTGTCTTCT
GCTGCAGTAACTAAGCGTTCTTCTCCGAGAAAAGATACACAAGTCGTCATGCGACCATGATGATGATCATGCAGAGAGCATCTGGAGAAAAAAAAAGAAG
TTCCTGAAGAATCGTGCGCATCCAGAAGCGTAGAGTGCACCTTGATATCAACGTGCTGCTTTTCCGTTGTTCGAGGCGTGAGCACAAGTGTATGAGAGGG
AACGGCGTGCTGACGTTCATCACCACGAGTGTAGAGGGCATGGGGGCGGCGCCAACCACCACATTCCACCTCGAAGATACAATACTGCGCAGACGCGTTG
TACAGAATAGCGCGTGACGCCTGGAAACCAAAGACCATAAGGTCATGTTGCGGCACGCCGTCGGTAGATGCCATTTGCCTCCACCAGAGCTGCTTGACTG
TGGAGATTCCTTTGATGGATTCACGGCCCAACTGTTTGATTGTCAGCGCCCCACTCGATCTAGTATCGTCTTCTAATGCATAAGAGCAAATGTGCCCGTC
ATGGCCACCAGATAGCATCGCGAGATGGCAATTTCGAGCATTACTAAGTAAAAGCGATGCCACCAACTCACGTCCGTGGACGCTCTTGAGCATGTGAGCA
GGGGGTTGGGCCGCATCAACATCGTAGTCGATGCTACTTGGAGCAAACGGACGATGAAAAAGGTAGACGTTACCATGCCCGTCGCCTCCCACGATATTCC
TGACCTTGGCTGATCGATCTACCACCAAGATTGACAAGATTGAGCTCTGTGTCGGGATTTTATATACAGCCACGAGACTTATTGCAACGGACACGGATGC
CATGTCATCGCATGCCTGCCCAATGACAGGCTTCCACTCGACGAGGGCGCCACCAGCACTACTAATAAAGAGAGCATCCTCTTGGTCCCACCAAATTTTC
ATAACACGAGTGTTTGCTTGTGAAGTCCATGCATGCAACAGATTCCCCGTAGATGCCTCAACAATACACACACGCCCCGTTACTTCGCCAACTAACAAGA
AGCGTCCAGAGAAATCGATTGAAAATGCCGACAATCCACCAGTGCGCGTTTGAATGAAATTATTCTCACTTGGAGGGACAACAAAAGCAAGTTTTGCTGT
AAGTGATATTAGATTCAGGCGAAAAATCTCGCCGCGCTCGGAGGCTACAAATGCAGTCTCACCATCATCGACCGTGCTCAACACAATGTTTCGTACACTG
TGAGATGATGGACCACCCTTCTTTTCGGTCGATATTATGGGAACACGAATAGTTCTACACACTTCACTCGTCTCCGGCGCATCAGAAGAAGACATGAGCT
GATGTGCGATATTCCAGAGTTTTACCGCACCATCACCGCCTCCTGTGACAACCAGCTGTTGTGACGGGTGAACAGCTACACGCCACACATGCCTGCCCAC
GTGACCCCGCAACGTGGCTACACAATGACCATTCAGATTCCAGAGCTTGGCAAATCCATCTTCGCTTGCTGTTACCACACCACATTGCCAGAAAGTGACG
TCCCAAATACGTGCCGAATGGCCCCAGGCCCGGAACACTGGCAAGTACGCACTCTGCAACAATTCAGCTCGACTTAATATCCTGGACATGTGCAGTTGCT
CGACCTTGGCGTTTCCATTGTTCGACCACAACTGCACAGTGCGATCGTCCGAAACCGAGGCTAGAAAGCGGGCATCAGACGACCACGCCAACTTGAAAAG
CACGCCCTCGTGAGCATGCAACCGTTGCGCCGGTGCAACAGCAGTGTCAGTATTGTCAAGTCCATACTCCATTGGATTCCACAACAGAATGTGCTGATAG
ACTGTTCCCGAAGCAACAATGAGCTCGTCCAATGAGCAGCCGTAGAACGCCAACGCGTACAAAATGCAGCGCTCAGTACACTGCACGCTGAGAAGGACGT
CGCGACTAGTGGGGTCCCATATTTGCACCAAATTGTGAGCAAGTCCAACCGCAACCAATAGATCCTTCTTCTTCCCTGATGTACCCAAATCATCCGTCAA
CAAGTGAGCATCGAACACCCAGTCGCTGAATACTTTCGGGTTTCCACGTGTCATGAGCTCCTTAATCTTTTGAGCTGCTTCACAACTTTGTGGTAGGTTT
GTAAAGCACGATACACGCTTTTGACCGAAAAAGACGCCAGCAAATGACTCTGAAGTGGCGCGAGGAAGTCGGACGATGTCGCAGCCGTGTAGAATACCAC
GAGCCAAGACAATGTGCTGACTTAGCAGCTCACCAGACGAGACAGAGTAGAGAAAGACTGTCGGGCCGACGCCTACGTAAAGCAGAGACCCATCGATAGA
AAAGGACAGGAGCGTCACTGCGCCCACGAACTCCTGCTTCTTGAGGAGCGCCATTCAAGTGTCGAATGACAAGCATCCGGTATACCGCCAAGTAAAACCG
GTAT