Description :
From Genome Similarity Track
Location :
Scaffold_386:26655- 30741
Transcript NameFunction/comments
g9415.t1POM74377.1 Reverse transcriptase [Phytophthora palmivora var. palmivora
g9416.t1hypothetical protein

Sequence
4086 bases(100 bases per row)
ACACCCATGTCGGCATGTGGCTTGAAGGAGGACGCGTACCTCGCACTCCCGGTTTCGTGTTACTTGGATCGCGCAGGGATGCCGAGTGGCAGAATCTAGC
TTTCCAGTCTACTACAGACCATGTGGAGGTAGAAGAGCATGAACTCGCTCCTACCGGACCCATGGTAGATCGACCTCAGTACGACACACCGATGAAAATC
CTGCGTCGTGACCGCGGAACCTCGAAATCGGTCGTCGCACAACTAACCGTGCCTCGACCCGCCGAGATGAAACCAGAAGCTGAGGGGTCTCCAAGGGATC
AGGAAGGTGGCACCGGCGATCAGGACGCGAGAGAATCTCCGCCAATAGAGCAGGCCACACGAAACGAGATGACTGCGGACCAGAGGGAGTCTGTGCCCCG
GGCCGAAACGCCTCTGATCGTTAATCCGGAACCGCTGGATGACGAAGAAGTATGTTACCACGAAGGTGGCGACCTGTTCGCGGAAGATGTGGAGAGACAG
ATGGCAATCTTGCCGGAAGTAGTGACCACCACCGATGAAGTCACGATCGAGGATATCCAGGTGGGCGATGCTGAGTCAAACACCCCGGAAGAAATCGATC
GCCTGCGACAGATAATTTGGAGGCGGAAACATCTCCTGATCGGGAAGGGGAACGCGTTACCACCAGCTGCCGTTGGCGCAGTCTGCGACATCGATGTGGG
AGGAGCAGCTCCTGTTGCACAACGTGTCCGAAAAGTCGCTCCACAGTTCCGTGAGAAGCTGTCGGATCTGATCAAGAGCCTGTTATCGGCGAAGATGATC
ACGCCGTCAACTTCACCGTGGGCCTCTCCGATCGTAATCATCATCAAGAAGAACGGCGTTGACATCCGGCTCTGTATCGACTACAGGCTGGTGAATAGTT
TGACGAGACTGATGGTGTACCCCATGCCGCTGATTAGCGATCTCTTGGAAGACTTGGACAAAGTGCTCTGGTATTGCTCACTCGATATGGCAAGTGGCTT
CTGGGTAGTCTCCATGACAGAACGCGCACGAAAGATCTCTGCGTTCATCACACCGTTCGGGTTGTTCGAGTGGACGCGTATGCCTTTCGGGTTGAAGAAT
GCGCCACAGATCTACCAGCGATTGATTGATAACGCGCTGTATGGACACTTCCGAATCCGCGCCGGTCACGATCCGTCGAAACCGATCGACGTGTTCGATT
CAGGCGAGCCAGAACCAGAGCCGGGACCGTCAGTGTTGGGAAGGCGATCGTACATCGATGATATTCTGGTGACTGCGATCACTTGGGACATGCTGTGTGA
GAAGGTTGAAGCACTGCTCGATGCTTGCGAACGATGGAATTTGTCCATCAGTGTGGTCAAAAGTTTCTGGGGCCGACGGAAAGTAGACTACTTGGGACAC
CGAGTGTCCGTCGACGGTTTGGAAGCCCATCCGAAAGATCTTGAAGTGTTAGGCAACCTTCCCTTCCCGCAGACTCTGCGATCGATGCAGTCCTTCCTTG
GAAGTTTGAACTACTACAGTCGGTTCATCGAAGACTTCGCGGTCTACGCCGCTGTCCTGTACGAGCTGCGCGAAGCGGATTTCCACGAGATGGGTTCAGC
AGAATAGGTCCATCCCCGGCGAACAAGTAGCTGGGGGCGTTGTCACGCGAGCAGAAGATGCTGACCGTTGGGCCCGAGCGAAAATCGCATTCACGATGCT
GAAGGCCAAGATCGTGTCCACCCCGGTACTGAAACATTTCGATCCAGATCGCACCCCGGTGATCGTAGTCTATGCGAGCCAGTGGGCGATCTCCGCGGCA
CTCGTACAAGAGCATGATGGCGTGTACTGGCCAGTAACCTTCACCAGTCGTACTCTGAAGCCCAACGAGATCAACTACGGGATTGTCGACAAGGAGGTCT
TGGCACTCCTGCGGATGCTAGACGTGAATTACACACTGTTGGCGACGAGGTCGATCTTGGTGCTGTCCAGACATTCGACGCTGGCGTGGCTGGTCAACTC
GGCTGGCTTCCAGGGGAGACTGGGTAATTGGGCAGCTTTGTTGTCAGAATGGACGTTAGAGATCAGGAAGTGCACGAAAGGGGAGGATGAGATTCTGGGA
GCGATCGCAGCAAGCATCACACCTCGCGCAGAGGTAGACGAGGCGTTGATCGCAATTGCCCCAGTAAAGCAGCCCCGACAGACGATCACCATGCCACCCC
CTACGGTCGAAGCGGATGAAGCCTTGCTGGTCGCGAGTTTCGACGGATCAGCGCGTGTCAAACGCAGTGGTGGCGCTTATAGCGCGATCGTGTGGAGGCT
GCCGGGATGGACGATCGTCACGGCCGCATCGGAGTACATGCCTGATCTGACGGTGAACGAAGCTGAATACCGCGGACTGCTGTTGTGTTTCGGTCTCCTG
TCCACTATGGACAGGGGGCGGGTCGTGATCTGCGGAGACTCCAATTTAGTGATCCGGCAAATGCGTGGTGAGATCGCATGCAAGGCCCCTGGCCTGTTGT
TATTGCGCGAGAAAGCGATGGATCGGCTCCGATCGTGGCCGAGACACGAGTTCTTACATATGAAACGAGATTGGAACCAGAGTGCGGACAAGTTAGCTAG
CGAAGCTCTTCAACGAGGCGAAGGAACCGTAGTTACCTCGGAAGCTGATCGACAGGACCTGATCACACTCAATCGGCTGGACGAGCTCCTGAAGCCGAAG
GATAATAACGCTGTAGCTCGTGTATCAGCGGTGACGCGATCGGCACGACGGTCGAGACGAGTGCCGAGAGTTCTGCAAGAAGCGATCGTGCAACGCATCA
GAAGTGAACGGATCACGCAAGCCCAAGACGAAGAGCAGTGGATCGCGAATATGAAATCGTACCTGCGGGGTGAGGTGACCGACCTGTCGTCGACCGACGC
TAAGTCTTGCGCCAAGACCGCCTGCGATTACGAGCTGGACGAAAGCGGCCTTCTGCTTTACTGCCCGACAACACCGCGATCGGACGAGGACCGAGACTCC
CTCGCGCGGCTGGTCATCCCGGAGACGCTACAACAAGACGTCCTGCATCATTACCACGCTAGCCTGGAAGGCGGGCACCAAGGGATCGGGAGGACTTACC
AGCGTGTCAAGGCGCACTTCCACTGGAGAGGGCTGTTCAGGAGTGTTCAGCGGTTCGTGGGAGAATGTGTGGATTGTGAAACTGGGAAAGGGCGCCCCCT
CATTCAGGGAGAATCGCCAGGGAATGTACAAGCTACGTACCCATTCCAAATGATCGCCATGGACCACATTCCGTCTCTACCGAAGTCGTACAAAGGAAAC
ACAGAGCTGTTAATCTGGGTTGACCTTTTCACCGGATACGTGATCGCGAAGGCTAGCGCCTCTCGCACGGCCCAAACGATTGCCGAGAATTACGAAGAAT
GCGTCTTTCGACGTTTCGGCGCGAGTGAGGTCATCCGCCATGATCGAGAGCCCGGTTTTATGTCAGATTTCTTCCGTGCTTTTAGCCGGATAGTGGGTCA
GAAACAGAGAGCTACGATGGCGTACCGGCCGCAAGCCAACGGAACTGCCGAACGAATGGTGCAGACTCTAACGCGATCGCTGAAGATGTACGTGTCAGAC
GTGAACCAGAGAGACTGGGACGAGTACGCGGAGCGACTCACGTTCGCTCTAAACACGGCCCAGGATCGAGTTCGTGGCGACACGCCATTCTACTTGGCCC
ATGGGTGGGACCCGCGATCGACACTGGAGGCAGCGCTACCGTTAGGCAGCACGCGCCGACGTGATCAGGAGCCCCGTCGATGGAGGTACCACGTACAAGA
ACACTACCAGCGAGCGCGGGAACAGGTTCGTGAGCGACTGCGCGAGGCGATCAGAGGCAGAGCCAACCGACACAACGAAGATCTGCGACCCCACAACATT
GCGGTGGGCGCTCAGGTATGGCTACACCTCGATCGAGTCAAGGAGGGGTATGCACGGAAACTTGCACACCTGTGGCATGGACCTTTTCGTGTCGCCGAGA
TGATCGACGATCACGCCGCACGTCTTGAGATCGCGGGTTCGGAGTATAGGATCTTCCCGATCGTGCATGTGCCCAAATTGAAGTTG