Description :
From Genome Similarity Track
Location :
scaffold_80:26654- 27876
Transcript NameFunction/comments
Plaha_PHALS_10198voltage-dependent l-type calcium channel subunit alpha-1s

Sequence
1222 bases(100 bases per row)
ATGTAGCAATGAACATTTGGTTTTCACGTCTTGTACAATTTATGATTTTGGTGAGCTGCATTTGTCTCGTTTTGGATGAGCCGTATCCCGAAATGAGCGT
GTCACCGCCAAGTAGATTGTTTGATTTTGCTTTATTAGCTTTTAGTAGGATCGCTCTTGTAGTACTATTTGTCGAGTTTGTTGTCAAAGTGGGTACTTTT
GGATTCGGCATTGAGTATCTGCGGTTGACCATTTTTCACAGCGATGAAATGTTGGGCTATGTCCATCGCCAAACATACATGGAGAACAAATGGAATCAAC
TAGATTTGGCGCTGCTACTGCTAGCAGTAGCTGACGAGATCATCACGACAATTAACCCAACATTTACACTTTCAAGTGTCTTTCGAGCTGGTCGTGTTTT
GCGTCCACTTCGAATGCTGAATCACAATCACGAAATGAAGGTCATTTTAAATGCTGTAGCTCGTTCTTTACCGCACGTTGGAAACGTGTTAGCCTTGTGC
TTGATTGTCTACATTATCTTTGGGATTGTAGGTCGGTCACTTTTCTCGGAACAATTTTACTTCTGCAACGACAGCCAGGTGGCAAGTGCGGAAGAATGTG
TGGGGTTCTACTTGGCCTATCCAAATGGCGTCCTACCTTTTCAAGAAGTCGTTGCACGAGGGGTACCAGGTGGTGCCGTTTTAACGCCACGAGTGTGGCA
GAACGCACGTTTTAGCTTTGATAATATTGGAGCCGGATTTCTTACACTACTTGAAATGACTTCATTGAAGTGGGTTGACAAAGCGTTTGCTGCCATGGAC
ATTGCTGGCGTTGGTAAGCAGCCAGTGATGGATGCCTCTGCTCAAGCAGCAATCTTCTTTGTCCTATATATTTACGTTGGATCTCTTTTTGTCATCCGCC
TCTTTGTCGGTGTGCTTGTTGAGCAATTTCAACGCAACAATGGCACAGAAATTCTTACAGAAAGTCAAAAGTCTTGGGTAGACCTCGAGAAATTCATTTT
GCTGCTTAAGCCGCTAAAGAGCATTCCGCGGCCTCGAATGAAAATGCAAGCGAAGCTATACGATCTGTGTAAGCATCCATATTTTTCGACCGGAATCTCC
ATTGCAATTGTTTTGAACCTGGTGCTTTTACTGGTCAGTCCAAGATCAGCAGGTGGCACTTCTTTATCCTTTAAGATCATTGAGATTATCTTTTTGACGA
TATTCACTCTCGAAGGATTAAT