Description :
From Genome Similarity Track
Location :
Scaffold_372:26653- 31671
Transcript NameFunction/comments
g8619.t1hypothetical protein
g8620.t1ETI41425.1 hypothetical protein F443_13328 [Phytophthora parasitica P1569
g8621.t1hypothetical protein

Sequence
5018 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATACACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGT
AACACCTTTTTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACC
CCATTTACAATCAATACAGTTCTCATTTACCATCAAAGCTTTCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTA
AGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCC
GTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGC
AACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACG
ATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTAAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCAT
CGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTAAGTTGGAAGAGAGGGGGAACCTCTCCTCCGTTGGCTTGTCGAGGTTGACACTGC
CATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGGGTTCGCCATGTCATGTCTTGGCGGACGAGCAAGGAGTTGGGCGTACGGACGCCGACTC
ACAGACCCTACGTGCTTTAGCACGTACGAGGATTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGTGGAGTTCC
TCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGAAGAGGCGACAAA
GGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATG
CAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGG
ACCTCTCGAGTGCGACGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCTCGCGAGTGC
ACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAACAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCT
GGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGA
ACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCC
TAGGCTTGACTTCGAGGAGGTGAAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTA
CGCTTCTCTTATCAAGTGAAGAAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGTTGTTGGGCATGCCGTGGCTTGCACGGC
ATGATCCGGTGATCGACTGGATGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACC
ACGTGGTGCATGCGGCCCTCCATCAGAGACAGCGCGGAATGCGGCTGTCTCCAGTCACCCGAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGAAGA
TGTGAAATGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACAGATAATGTCGACACACAAT
TTGTCGAAAGACACTCCGCCGTTAGGCGTCGAGGTAAAGAAGGCGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTCGCAAACGTCCCGC
ACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGATGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCC
GACGAATATAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGC
TGCGCAAGTCTCGGTCAGTGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACGCG
TACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTCGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTC
GCTCGCGACCTGCACGATGGATGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTG
AGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGTCTGGGACTCGCTCAAGGCGAGCCCCTTCTACAAGGTACAAGGATG
TACTCCCGGACGACATTCCTGCGGTGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTG
GCCACTGCCGCGTGAGCAAGTCAAGACAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCT
ACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTATAACAAGCTGAACGATACGACGGTACCGGCACAGACGCCGATACCTCGAA
AAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGGGATATCCC
TCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGGGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACG
CACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTAGACGATGTGTTCATTCACAGCCGGGCTGTGAATTGGAGGTCGGATGTGGAGATGCATA
CAGAGCATCTCCGCAAGTTGCTCGAGCTCATGCGAAAGCACAAGCTCTATGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTTG
GTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTGAAACGTAAAGGAACTGCGGCAGTTC
CTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCACGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGA
CTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTTCACGTTGTGTG
CGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAACCAGCT
GAGCGCAATTGCCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGATCTACACCGACCA
CGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAACGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAA
CCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCCGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGACGTCGTCAGGACGACTA
CACCCTCGTCGTCCTTGTTGGATGACGTGAAGGCCGCATACGCGCATGATGCGGATGCGAAGCAGTTGTTGGAGTACTTCTCCACACCTTCTGACAAGTC
TCGTCAGAAGCTGGCCAAACACATTCGTGCTCGTGTACACCGTTATCGTGTACACAATGGTCTACTGCTTTACAGCGCAGTCGACGACAACGCAGATCGC
ATTGTCGTGCCGGATGATCATGAGTTGAAGCTCAAGACCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGATATACTTGC
TTCTCACGCGTGACTTCTACTGGAGTCACCAGTACAAATGGGTACGCAAGTACGGTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTC
GCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTTAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACT
GGTATAGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAATAGACGGCATGGCTGTTTGTTGACC
TGGCGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGGTTACACTTCTTGGGAC
GCAGTTGTCCATGTCGAC