Description :
From Genome Similarity Track
Location :
Scaffold_44:266524- 271620
Sequence
5096 bases(100 bases per row)
TGCCGGATATCACAAACATCGATGTCGTCCAGCTAACACTACCACCACATTGCCACATGTGTCCTGCTAGTGACAATTTCCGTGCAATAAAGGAAAGGGC
GACAGATCCAATGTGATCGTATTGAGCAAAACCCACCGTACAGGATCGAGTCGACGACAACAGTAATGTTACAGCCGTCGAAATAACCGACGCGGCGCTC
CACGCATACCGCGGTCAGGCCTCGATCACCACGCATGCCTTCCGATCATCCCTCCCACGGGTATCGACCGAACAAACCACGTTGGTGGTGGTAGACGAGA
AAGAGGTATACAGGGGCCAGCCAGCAACCCGGCACGACAAATTAGTGGACACTAACCCAATAAATTGGCGAGAGTCACGGCTGCCATGGCATGAACGGAG
GAGCCGTTGCTCACCAATGAGACCTGGTAGGACATGTGGCTATCGTTGGTAACGACTTGGCCGGTGTGTAACCAGGATACATTTCCCGGGACAATTTTCC
TACATTCCATAGTACTACGGAGGAATTGAAACGAGCATTGTCCGCGCCACCTGTCAAGCTGATGCTGCTTCTTCAAGATTTCCATACCAGGGTTCACTGT
TGGATACTCTCGATGACGGGGTTCTCATGTCTTGGACAGCCGCCTGGCGTTGCGACTGCATGTATCAGGGCCTCTATACCTATCACAAACATGTGACCTA
CGCGCAACGATAGCGTGGCTAGAAGCCTGGAAAGCAAGTACGACACGTGTGACATCTGGGCGAGTACTAGCCCCACTTGTTGACAATACGGATGAATGGA
TAAATTTGCGCGAAGGTGACTATGACAGGGACGAGCGATTGCAGCTCTGCGACATCTGTAACATACGCCAATTTGCACGAAACGCCACCGGTGCATTTTT
GCACAATGACGGAAATAAGGCGCTACCCGATCCAACGGAGGAGTATGATGGAGAAATTCCGGTCCGCATTAGAAGGCGTTTAGCAGCATTACGTTCCAGC
GCGGATTACCGACAAGCATTCGGAGCAGCAAGCCATAGAAAGACCTGGAGTATGCTTCATACATTCTCCGATCAGTTGCTAGATCACGAGTCCGTTTGAC
AGACTAATGATTACTGAGGGCTCCGCAGTGAGAGACGGGTAGCATCTTCCGCCATTGATAGGGCGGAAATGCCATTAATTTACAGACCATTCGACTGTGA
AGCACCTATTTTGACCACGGACACTCCCAATACCCACCAAATCCACCAGCGGACACAAAGTATACCACTCACAAAATGCGAGGGGCTTAACGAAAACGGA
CCAGATCAAATGGATGAGAGGGTGGAAGCAGCAAGGAAAACACCAGAGTACTATATTGTAATGTCCGCAGGAGACACGCATCAATCTGAGAGTGCAGCTC
AGGAAACGTATGATACATGGCGATCCATATGGAGCTTCCATTTTGCTTAACACGCTCGACCATTATCCGAGGCATCTTACTGGACTGTAATCACGGAGAA
TTCTGGGGGAGTGCCGATATTGCTTGACCCGACCAAACAATATCGGCACTCCCCCAGAATGTTATGAAATGGCACCCGGAGCTTTGGACTAATAGAGTCA
TTGCAGTCGTCGTGGATGAAGTCTTGGTGGTAAAAGTGTATGCACCCAATGAAAGACGGGAGCGGGAACAATTCTTCAATAATTTATAGCGGTGGACATG
GCCTGAAACGGAAGTGCTTTTCTTTAGAGATTTTAAGTGTGTTCAAAGTCCTCATCCTGACCGGCTGGGTGGCTTGCGGTCAGGGTGACCGTAAAGAACA
GCTATACCTACGTTACTAGACGCTTTAGATCTTGAGGACGACACAATTCTGGCGGTAGTGGCAAGTGGAAGACGATGTCATCGAGCCGACAAACTACTAC
ACGTATTGGAATGCGCGGTCAGCTAGCACGATCGACCGTTTATATACACGCAAGTATTATAACGCAACTTTTCAGCAGGTGCAAGTACGCCTATTATTTT
TTCTCAGAACACGATCAAGTCACCTTGCACGTGGCGAAAAACTAGTGAAAGCAGCGTCTGCTAAGTACAGCCAAGATGTTACGGTTTTCTATCACTCGGC
AACACCATAGCGCATCCACGCGGATCTATTGCAAGAGCTCATCAGAACCGAGGTTAGTTGCGACGTAACCTCGAGATCTTGAGTCACATCTGTCCATAAT
TGCTAAGCAAACATTAATCGAATTAAGAAACGGGACTATCAAAGGGCGCGTCGAATGCGGCTTCAGGTCCATGCTCCGGCTCCTCTCTTGACACGTCACA
GCTTAATTCAAAGTATTCAGAAAGAGCTCCAGACCGCACAAACCGTCCGACAGGAAATACGATTGGAGCGGACTATGGAACGCATCAAATGGAATTTTCA
ATGGGCATTAAACTGGGAAAGGGATCAATCTGTATCAGTTCTTTAACCGATCAACGGACAGTCCGTCCTACGGGGGGCACGGAGGCCAACCATTTTGCGT
CCGCATGACTCTCAATACTCTGTGGGACTCACAACACCTTCAATCAAGTCTTGTACAATTGTATTACGCTGCCAGCGGATCGCATCGCGGAATCCAATGC
GCTCGTGATGGACCAAATAACAGTGGAAGAAGTCCTTGCATAAATGCGTCACGCCATAACGCTGCAGGATCGGACGGATATAATAATATTTTTTGAGAAA
TTTCAAGCGCTACTGGCTCCTGCGCTCGTCAATATCGGCATTTTAAGAATTATTGCAAGGGCGTACTATCCCCGCCTCTTTTCTGGAAGGGTTAATAATA
TCGCTCCCCAAGAGGGGTAATTCGAAAGACGCGATGGATTACAGACCGATCGCCTTCTTATAAACTGTTCATAAAGTTGTCGCTAAGGTGATATCACACA
GAGTCCAACAGGTCATCGGGGTGCCCATTCAGGACACGCAAAAGGACTGTCCACGAAAGATAAATGTCGAAGACGGTCATGATGGCGCATTTGAGTTCTG
CGATGTCCGAATCGGAGCGGGTGAAAACTGAAAGCAGATTCATCTTGCTTCTGGATTTTTGTAATGCATATGACACGGTCTCATGAAAATTCTTATTTTA
GGTGTTACGGTTCTTTAGCTCTGCGGAAGCCTTTATAAAGCTGATACTCCGTCTACGTGAAGGCACCAAAGCGCGATTCTTAGTGAACAGAATGCTATCA
GACCCTACCCTGTACTTACGGGGGTCCAAAAAAAGGTTGCCCATTGGCCCCGCTGCTTTTTCTACTCGTGGCAGAGACACTGGCCATTGCCATACTGCAA
AATACACGTATTAGAGGGCTCCAACATCCCAGATTTCTGGACTAGGACAACATATATTGGCTTTTGTTGACAATTCGACGGGTTTCCTCGAGCGGGAGGA
TCAGCTACAGCAGGTGCTGGTCATTGTCCAGCGCTTCGAGGAGCTCTCTGGGCTGTTTGTGCAACCAGCAAAAAGTGTGTTAATGGTAATTAATACAGCG
GTGGAGATCAAGGAGTATGAAGGGATTCCGTTGATCCAACATGGAGATACGACTCGGTATCTTGGGTATCATGTGGGAACTGGAGACCTCGTTGACGCTA
ACTGGGCATTATGGGTCCGTAATTTCAGAAAGCGGCTGGCCACAGCGGCCGGTAGTAAAATCATTTTCGCAGTCCTAACCTTGCTGCTCAATTCTATCAT
GCGTCCTGCCGTGATCTTTACAGCAGCTGTCTTCCAAATTCCCAAGTGGGCCAAGAAGGAATTGTAAAAACTTTGACAGTAATTTCTCTAGCATCATTTT
ACCTCAACGGCAGGCAGCAGACATAAGGTAAATTCAGGCGTGCTGTATAATCCACGTGGAGCGGGCGGAATGGGCTTTATCTCCATAGATGTCGCAATCA
GCGCGATAATCTTAAGCAAGCCATGCAATGGTTGAATTACAAACGGGATCGCTATCATCACGCGTGGGTAGCGTGGACATTTCAGATACCGAGGCCTCAG
CGAAATGGAAAATTTCTCCGGGCTTCAATATCTCTCGGCGACACTGTTCAACTGATGGCTCTCAACCAGATATACAAGCAGATTCAGTGCACGGATCGCA
CCTGAGAAGATTGAATTGTTGACTATCCAACATCATCGGCACGGATCAATTCAGCGCCTCATAGCCAATCCATTAGCCACTCAAGAAGGGCATAAATTGC
TTCTACAGTATTACGAAGACATTCCGACGCTCACGAATATGTACACTCAAGAGCGCAAGACTTTCTGGGAAACTTATCGATGAGATCAGGACCCCAGGAT
TTTAGATGAAAAGGGGCCAACGCTAACAACGACGACCTACCCGCTGCTACGGACATGTACGTTATAATAATTACATCACGCGAGTGTCGACGCTGGATTA
AAGGATTCGTCTTCCATATGCGGGACAAAGTAACTGCCACACAATTCCCAAATTAGGGCTCTGGGCGACGGCATTACTAATGGCCTGGCCAACTCTCCAA
GTCGAGAATATAGTCTGTGTACCAACGTAGCTCACTTTATGAGACGGACCTGAGGTCCTGAAACGATTTACATGGACACCAACAAGACCAGGTGTTGTCA
GCGGCAATCTTCGCGACCCCTGGGATCAAGCATGTCATCGTCATCCTCCATAAGGTGACTAATGGTTTTCATTGGGTCATAGGGCATATGAACGGGCTAC
CCGCAGAAGATGTGCATGAATTAAACGCCACGCAACAGAAAACTCGCAACAGAGCGCTCGTACTAGTAGCGCATTCGCTACTCCTTGGGTTTCTGTGGTG
CCTTTCTCCGACAGTCAACAACATTCACGCATATGCAGCATTAAAGCGCCAGCCGTTCCAAAGGGCGAAAAGACATTTGGCCCCAGCTACCTCAGCGGCG
ATCATCAACTCCACCACAGAGCTAACTCACACGAAGGCGGGTATTTCCCGTTGTCTCAGAATCCGACGCAGCTATTGCCGCATCGCCATGCCCTTACTCA
AACCAAATTTGGGTCTTCTACAGGGTAGCAACCCATCAGTTAAATCTGTATCATCCGGGGCGAGAGCTACATGCCTCGTGCAAGCAACATCCTAAG