Description :
From Genome Similarity Track
Location :
Scaffold_775:2665- 5556
Sequence
2891 bases(100 bases per row)
GAAGGGAGAAGATTAAATACTCGGCATGCTTGCGGCAAGTATAACACCTCGTGAAGAAGTAGATGAAGTGTTGATTGCTATCGCCCCAAGGAAGCAGCCA
AGACAGACGATAAGCATGCCACCACCCACAGTAGGTGTGAATGAAAATCTGCTGGTAGCCAGTTTCGATGGATCAGCCAGGGTGAAAAGTAACGGCGGAG
CATACAGCGCGATTATATAAAAACTGCCAGAGTGGACGATTGTGGCTGCTGCTTCCGAGTTTACCCCTGATCTGAACGTGAATGAAGCAGAATACCGAGG
GTTGCTCCTCAGCTTCGATTTTCTTGACGGTCATGCTAGGGGGCGAGTGACTATTTGCGGAGATTCAGATTTATGGTTCTGCCAAATACGAGGAGAAATC
AACGGTAAGGGGACCAGGACTGCAGTTGCTGAGACATAGAGCGATGGAGAAACTCCGATCGTGACCAGACCATGAATTCTTGCATATGAGGCGTGATTGA
AATCAGAGTGCAAATCTGTTGGCGAGTCAAGCACTATGGAAAGAGAAAGGGACAGTTGTGATTTCGGATCAGGATCGTCAGGATCTGATCACTATTAATT
GGTTAGACGAATCACTATTACTAGAACGAGTCGATCATGCAGTCAAAGTGGCGGCCACCACTTGATCAGCTCTAAGAAGACGCTATCAACCCGGGATTTT
ACAGGAAGAGGTGGATCGATCTCATTAAGCAAGTACTAGACGAAGAAAATTGGATATCTACTCTAAAGATATATCTGGGTGGAGATGTGGCTAAATTAAA
GGCAGCTGAAGCCAAAGTTTGCGCCCTGATCGCACCGGATTACGAAGTAGACCAAAGGGGCTGCTATTCTTCTGTCGGCCACCGAAGCTGAAGATCGTAC
TGAACTGGCTCATTTGGTGGTTCCAGAATAGTTACATCGAGACTTCTTGCACCACTACCACACAAGTTTGGAGGGTAGTCACCAAGGAATCGGCCGTACC
TATCACAGATCAGGGCGAATTTCCATTGGCGTGGGTTGTACCGAAGTGTGCAGCGGCATGTGGGAGAGTGTGTAGATTGTGAAACGGGAAAAGGACGGCC
GGGGATCGAAGTGAATCACCCGGTAATGTGCAATCAACGTACCCCTTTCAGATTATAGCTATGGATCACATCCCTTCATTGCCAAGATCCTTTAAAAAGA
AATACCGAGCTGTTGCTGTGGGTCGATTTGTTCTCGGGATATGTGATCGCAAAGGCAAGCTCGTCCAGATCTGCCCAGACGATCACAGAGAATTACGAGG
AGTGCGTGTTCAGACGATTCGGTGCGAGTGAGGCGATACACCATGATCGCGAGCCGGGATTTATGTCCGATGTTTCCGAGCGTTCAATCGCATTGAGGGG
CAAAGTAGCGCGCCAACATGGTGTATAGACCGCAAGCGAATGGTAGGCCGAACGCATGGTGCAGACGCTGACTCGATCGATCAAGATGTATGTCATGGAT
GAAAATCAAAAGGATTGGGACGAATACGCAGAGCGATTGACTTATACGTTCGACACCGCTCATGATCGAATTCTAGGAGATACACCGTTCTACCTGATTC
ACGGTTGGGACCCAAGATCGACCTTGGAAGCAACCTTACCGTTGGGAAGTACCAAACCCCGGGATCGAAATGCACAAAGGTGGAGATTTGGCATACAACG
CCAATATCAGCGTACGCGGATGGTAGTGAATGACATTGGAGGCTGCAATCCAAGGTCGAGACGATCGACATAATGAAGATCGCGATTTATTGGATATCGA
TCGCGGGTCACGAGTTTGGTTATATCTGGATCGAGGCAAGGAGGGATACGCTCGAAAGCTAGCCCATATGTGCCGTGGACCTTTTCGAGTAGCCGAAAAG
TGCGGCGATCATGCTGTAAGGTTGGAAATCGCGGGTAAGCCGTACCGGTTATTCCCAACGGTTCATGTTTTTTAAGTTGAAGCAAGTTCGTGTATTTACA
GATCGCCCTACAAGTAGGCTGAATTTGGATGAGGCGAGTGGATCCAATTTTGACGAAGCACTGTTGCCAGAGGATAGTTGGGAGGGTTATCTGGACGCTC
ACGAATTTGAAGTGGATAAGATTATCGATGTGCCATCGGGACGGAAGACGAGATATGGCCGAATACACAAACAGTACCTGGTACAATGGAAGGAATACAG
CGACACAACTTGGATTGATGAAGCTGATCTATATTGTGGAGCTATGTTGCAGGAGTTCGATAGCGATCAGGTGAGCAAGAATAGTTTTGAGGTGATGCAA
TCGCACGAGGAAGAAGCCAGATAATAGCGATGATCGGAGAGCTTGAGTGGATGAGTATATGCAGGGACGGTGCATGGACGGGAGGAGAGCTATGGGTGCA
AGGAGGTTGTACATGGAGATGGTATGGAATTTATGTGAATTGAGTGCGATGATCGTAGACCAAGTAGTGCGACCACGATGAAAAGACAATAAGAAAGAAG
GAAGAAAAACAAACTATGGGAGCGATCGAATGGAAATGAGAAGAAAGTATATTGAGAGATCGCGTCATGGAACAGACCAAGTAAATTACTCGCGGTCAAA
GAACTTACCAACCAAGAGTGGAAGAGACGAACCAGGGTGGGATGCGATCGAAGGTCGAAACTGGTTCCTCCAACGCTCGGTAGAGTGATCGATCGAGAAG
GCAGTGATCAAGTTGGGTATGTTGGTCCGCCGCACGGATAGGCCGGGATACCACACCCTAGCCTCATTCGGACGAAGAAAGTGTAGAAACATGGGTCCGG
TAAAATGTCCAAATCACAGAGGCCGTCGACCATGCCTTGAAGAATCAGCTTCAGTACCCCCTTCCAACGGGAGTCAGCACGAAATCGTCGC