Description :
From Genome Similarity Track
Location :
contig_72:2665- 3867
Transcript NameFunction/comments
g9767.t1hypothetical protein PHYSODRAFT_340298

Sequence
1202 bases(100 bases per row)
CACGGCGTGTAGACGTCTTGGCGGCACCGTCGAAACTCAGGATGTGGCCTTCAAAGTCAGCACCCAACATCTCCAGACTAATGGGAATTATTGGTGCGAC
TCGACCCTTAGCCGGGATCAAATTCTCCGCGACTTCGTCCAGGTGTTCTCTAGGTGTGATTCCTGCATCTAGGATGGCAGGTAGTCCGTCTTCATCACGT
TGCACTCTGCGGATCTCCAGATTCCAGTGTGACAGGATTACGCCCCACTTGACGTTCTTACCGTCTGCCGACTTGGATGTCAGTAGCCACTTAAGCACAG
AGTATCGGGTGTATACTACGATCTTTGGACTGTGTTCCACCAGATTCCTGAACACTTCTAGGACTCGCATGATTGAAATCACTTCCTTCTCGGCGAGCTG
GTATCTCAGCTCAGCGTCGTTCAGGACGCGCCCCGTGAAGCGAACCGGATGAATGACTCCGTCGTACTCTTGGCCTAGTACCGCAGACGCTGCCCACTGA
TTAGCATGCGGGATGATCACAAATGGTCGTGTGCGGTCAGGATGCCGCAGTAGTGGAGTCGATACAATCTTGCGCTTCAGGATCTCAAACGCTTCCTTGG
CTCGCGACAAGTCTCGTCCAGCACGTATCTGTTCGTCCGTCAGCTCATATAGGACAGCGGCGATCACGGGGAGGTCTTCGATAAACTTATTATAGTAATT
CAGACTTCCCATGAAAGACTGCACTCCCTTGAGTGTCTTCGGGAACGGCAAATCCTGGACTCCCTTCGCAATCTTTGGCTTCGCCCGGATACCTTCAGCA
CTAATTTCATGCGAGAGGTACGGGATGGACAACTTGCCAAATTCGCTCTTGGGTAGACTTACAGAGATATTCCAATAGCGTAACCGAAACAGTAAAGCGT
TCAAGTCTTCACACAGGTGATCCCATGTTGGTGCACCATGAGCGATGTCGTCAATGTACGAGCTGCGCCCGAGCACAGGGCCCATCTGAGGTGGGGCTGG
GATGTTACGCTGGAAGACTGTCATCTTATCCGTCAAGATCGAGAAATCCTCCTCAGTACTATCAGGACTCCTGGGTTCCAGAGGATCAAGTTTCAGGAAA
TCAAGTACGTCAGGGTCCACCTTTGCTTCTTCCTCAGAATCCAGGCGAACGAATCCCCACAGACAGTTGTTGATGACTGCTTGATAAATGAGTGGGGCGT
TC