Description :
From Genome Similarity Track
Location :
Scaffold_79:26645- 31474
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_79-snap-gene-0.31AP-3 complex subunit delta
Pytir_DAOMBR486maker-pir_contig_79-fgenesh-gene-0.18Conserved gene of unknown function

Sequence
4829 bases(100 bases per row)
CGGCGCGCCTTCCCGCGGTAGCCCCTCTCCACGCCTGCTAGACGAATCTACGCACCCCCGCACCGCGCGCACTCGATTCCCCTCGCTGCGTTGCACCATC
TAGTGACTCCGCTTGCGTCGAACGACCCCGAATTGACTGCGCTGTGACCGATTGAAGATAGTCCATCAAATCAAATATGTTTGAGAAGAACTTGCAGGAC
CTAGTGAAGGGCATCCGCTCGGCCAAGGGCGACGTGAACGTGTACATCTCGCAGTGCATGCAGGAGATCAAGAACGAGCTCAAGAGCACGGACCAGTTCG
TGAAGGCACAGGCGATTCGCAAGCTGACGTACCTGCACATGCTCGGCTACGACATGTGCTGGGCGGCGTTCCACGTCGTCGAAGTGATGAGTTACGAGCG
CTTCTCGCACAAGCGCATCGGCTACACGGCGGCGTCGCAGAGCTTCACGCAGTCCACAGACGTCGTGCTGCTCTGCACGAACCTACTCAAGAAGGAGTTT
GGCAGCATCAACGAGTACGAGGTCGGGCTCGCGATCAACGTGCTGGCGAACATCGTGACGACCGACTTGGCGCGCGACCTGCTGGGCGACGTCGTGGCGA
TGATGAACTCGCCCAAGTCCTACGTGCGCAAGAAGTCCACGCTCGTGCTCTACAAGATGTTTCTGCGCTACCCACAGGGACTGCGCCTCACGTTCGACAA
GCTCAAGGAGCGCATGGAAGAGCCCGATGTGTCGGTCGTCTCGTGCGCGGTGAACGTGATCTGCGAGCTCGCGAACAAGAAGCCGAAGAACTACTTGGGA
CTCGCGCCGCAGTTCTTCCGATTGCTCACGACGTCGTCGAACAACTGGATGCTCATCAAGGTCGTGAAGTTGCTCGCGAGCCTTGTGCCCGAAGAGCCGC
GGCTCGCGCGCAAGCTGCTGGACCCGCTCGCGACGGTCATCCAGAACACGCCCGCCAAGTCGCTGCTCTACGAGTGTATCAGCACGGTCACGACAGCGCT
GTTGTACACGAAGAAGAGCGACGGCTCGCAGCCGCGCAACGTCGCGGCGATCGTGCGCCTCTGCAACGACCACTTACGCCGCTACATTGAAGATCCGGAC
CAGAACCTGCGCTACCTGGGACTCGTGGGGCTCAGCAACCTGATGCAGAGCCACCCGTATGTGATCGCCGAGCACCAGGAGCTCATTGTCGAGTGTCTCG
CCGTGGACGACATCACGATCCGCATGCGCTCGCTGGAACTGCTCGCCGGCATGGTGAACCCGGAGAACGCGGCACAGATCATCCGCGAGCTCATGCGCCA
GACGCTCTCGGCCGACGGCGCGTACCGCCATGAGCTCATCGCGCGCATTTTGCACGTCTGCTCGGTGAACAAGTACGAGAACATCCATGACTTTGACTGG
TACATCCACGTGCTCGTGCAGCTCGCGCGCGTGCCGGGGATCTCGGGTTCCGCGTTCGATGTGCAGTCATTGGCCACTACCACTGGCAGCATCAGTGACG
CCGCTGCGGCTGCGTCGGCGCTCAAGATCGGCTCGTACGAGATGACGCGCACGCGCTCGCATGGCATCGAGGTCGCACGCCAGCTGCTGGACATCGCCGT
GCGCGTCAAGAGCGTGCGCAGTGTTATGGTCGAGAACATGATCGACCTGCTGATGGAGAAGGATGCACTCAGCGGCCCTGGCGCGTCGACACTAAGCGAA
GTGTTCTACGCGGCGGCGTGGATCTCGGGCGAGTACGTGATGGAGTACCTGGAAGACGTCGACGACGACGATGAAGACGAGGACGAGGACGAGGATGACG
AGCGCGTCACGGAAGAAGAGAAGCTCGCGCGCATTGAAGACCTGGTGGATGAGATGCTGCAGCCGCGCACGACGTCGCTGCCGGCGCACGTGCAGACCGT
GTACATCCAGACGCTGCTAAAGTTCCTCGCTGCGACTGCCGAGAAGTCCGACGACGACGCGGTCGAGAAGCTTGCGGAGATCATCGTCGAGCGCCTGCCG
GCGTTCGTGCAAAGCGAGCACATTGAAGTGCAGGAGCGCGCGGTGTCGCTGCAGCAGATCCTCTTTGCGCTTGGTATCGGCATGAGCGCACTGAGCTCGG
AAGAGCGCGCGTCGCGTGCGTTCGACGGCAGCGCGTCGCTGAACCCGTCGACGCGTCTGGATATCCTGAACTCGTACTTTGCCGAGCGCCTCGCGCCTGT
GGGCATCAAGGCGCAGCGCAAAGTGCCGCTCCCAGCGGATCTAGATCTGGACGAGCCACTGAGTTCGATGGAAGCGTCGTTCCTGGAATCTGGCGGCGAT
GTCTCGGGCTTCACGAACGAAGACGACCTCGAGGTGTCGTTTGTGCAACAGGGCAGCTTCAACAACAGCGGCCACAGCGGCGGCTACACGGTCTTTGACG
ACTACCCTTCGCAACATTCCAGTGCTCCTGGTGGCGGCAATTCAAAGAAGAAGAATGGCGGTAGTGGACGCCACCACCGCAAGGACTCGTACTCGGGCAG
CGAGTTGTCGGTCTCCGAGTCAGAGGACAACAAGGAGGAGCTCGAGCGCCAGCACGCGCTGGAGAAGGAGCGCTTGCGGAAAGATCCGTTCTACTTATCT
GGAAGCGGCAACAACGCGAACGGCCCCATCGACCACAGCGTATGTTTCACATTGTTTTGCTTGTGTGAACCATTTTCATTGCGTCATGGATTGACGAATA
TTTTGTTTGTGTTTGTTTGTTGTATCAACAGGGCTTTGCGGGTATCATGGACGCTTTGGACACGAAGAAGAAGAAGAAGAAGGGCGAGAAGGTGGGGAAA
ACTACAGTCAGTAGCTACATGTTTGACTGGCTGATTTCTGCTAGCAGTGGTGGCGATTCTGGGTCATCCGCATTTTCTCACACGCATTTATTTGTTTACT
GATCTCTACACCTCACAATGTCGCAAATCGAAACAGCGCTCGAAAAAGTCGCGCGCAATCTTGGAGGATGAGCTCATGCCGGACGGCGCACGCTCCAGCG
ATGAAGACCGTCGACGCGCCAAGAAGAAGCAGTCGTCCTTGTTTGACGAGGTAATGAATGGATATGCAGTGCTAGGTCTGTTGGTGTACCAATGGGATGC
GTGTGGCTAACACCGGTTTTGTATTTCCATGTGCAGGACAATGATCTGTCTGCGATCGACCTGAGCGTACCTCTTGGCGAGAACGAGAGGATCCCGGACG
AGCACCTGTACCACCGCCAGACGAAGCAGGACGAGGTCGAGCGCAAGAGCAAGTCCAAGAAGTCCAAGAAGTCCAAGAAGTCGAGTAGCTCCACGAAGGA
GGACCGCAAGTCGTCCAAGTCGAAATCGTCCAAGTCCAAGCACCGTCACGAGGACGACGCCGAGGACCGCGACCTGAAGGATGACAAGAAGACCAAGAGG
CACCACCATTCTCGCTCCTCGAAGGAGTCGAAGGAGAATATTTATGACAATGCGAGCTCGGAAGAGGAGGAGGAAGCAGAAAGCCGCCACCACTCGAAGA
AGAAAAGCAGTCATAAGAACTCCAAGTCGTCGTCGCGTCACCCGCCGTCCAAGCACCACGACGAGACCAGCGGCAGTGGGCTGAAGGAAAAATCGTCGTC
GTCGCGATCCAAGAAGACGTCGGAGAAGTCGTCGCGAAGCAGCAAGGACAAGAACACCAAGAAGCAGGAGCAGGATGAGCCGCTGCTGCTCTTTTAGACG
TACATGTGTGTATGTGTGCAAAGAAAGCATGAATGAAAAAATGAAGAGAACTGACAAACAGTGGGGAAGAGATGGGAGACAACAAACATACCGCGTGGAA
AAAACGCTTGGGAAAGGTCGAAAGGTGCAGGCAACGCAATGATGAAGAAAGTACTTGGCTGCGTGCTCATCTAAAGCTGCAGGTCCCTGTTGCGCGGGTC
CAATGCATACTGCTCTAACAAGGGCGCTATTGACACGACGGCGCTCAGGAACTTGGTGGAAAATGCAACTGGAATATTAATTAGAGACTGAAATCGCATA
CTTGGGCTGTGGTGCACATGCGCTGCAACGCTGTTTCTCTCTCTCTCGCTCTCGCTCAGAGTCGTCGAGGTGGTGGTTGGTCTATCGATTGTGGTGCTGC
CTCTCAGCTTGGACTGTGCACACTTTACTTCTTGGACTTGTGGGCCTTCTTGGTGGCTTTCGCCTTCTCTCGCTCGTCCGTGTCGTCCTTGCTCTTCTTG
CTCTTCTTGCTGCTCTTGGTCACTTCTACTTCTTGCTCGTCCTCCACTGGCGCTTCTCGCTTGCTGCTCTTGATGTTGCTCTTGGCAGTCACGTCGGCCG
CGCTACTTGAGCTTCGATCCTCCACGAGCGAGAACACGCGCGAGAACGGCTTGGCGAGCGAAAACTTCTTGCGGTCCGCTGACAGCGGAAACGCGTTCAC
CAGCTGCTGCGTGAGCAGCACGTCTTCGTGCTGCAGCTGGTACTTCTTGCCATCGCGCGTGACGCTCGCGACTGCGTCACCTAGCTCGCCGCCCTTGACC
TTGAACGACACGTTCGCCAGTGCCGACGCGTCCATCTATAATAGCAGCCATACACGCATAATAGAGTGAGTCAGCACTTCGATAGCCATAAACGCTCTGC
ACAATGGATTCAGTCGAAGCGCAGAGCAGATCGACACATACGTGCTTTGGCAGCTTGAAAAACCAGAGCTCCTTGTCTTCCGAGAGCACGGCGTCGCGCG
TGATTGCCGAGCTGCCCTTCACCGGCTCAAAGCCAGGCGGGATCTCAAACTCCCTGTTCAATGCGCACAAGCAGCAAGCACCGTATCAGCGTCAGTACGA
TGATCAACCATACCGCTTCATATACTTGC