Description :
From Genome Similarity Track
Location :
Scaffold_17:266436- 269181
Sequence
2745 bases(100 bases per row)
CGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTTAAAAGACCCACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGA
CCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCA
GGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAA
ATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACAGCGCGCTCGACTTGGTCGATGGCTAC
TACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGA
ACGCACCAGCAACGTTCAATCGTCTTGTCACGCAGCTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGC
CGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGAGTACATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGC
GTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATTCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGG
TTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGTGCGAACTACGCGGGGATGGCTCGGCCATTATCAGA
TCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGAAGAGCCTTCTCCAGGCTCCGATCCTTGCGCTA
CCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGA
TCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGT
ACACCTGCTAGGCTCTAAGCCTTTTGTGATTTTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGG
CTTTCCTTCTTTGCCGAGTATAGCTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAG
CTCATGTCACGACAGTGATGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGA
AGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCGCTCGATGGCGGCCTGCTGTACTACAGCACCGACTCT
GAGGATAATCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGG
AGAAGACCTACGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAAA
GTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGATGTTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGAC
AAGGCAGGAAACACGGGTATTGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATTTAGCGGCGGTTCCGGACACCATAGATGGTGAAGGTACAGCTT
TGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTT
CAGAGTGCTTGGCACTCGGTTGGACATGTCCACAGCGGACCATCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATATCCTCCGA
AGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGT
TCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGT
CAGCCCTGTTGCGGTTCGCAAGCAAGTCAATGACTTTGTCTCTTTGAGACTAAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGATATG
CAAAAAGAACATGCAGATGCCAAAGGCAGACGCAATGAAGAAAGGTTTGAGGTCGGGGACCAAGTTTTATTAAATGCAAAAAACCTACCTACTCATGCAG
TGTCTGCAGTCTTTAAGACAAAATTGAGACCACGGTTCATAGGACCGTTCAAGGTCGTGGCCAAGAAGGGCCTAGCGTATACGCTTAACCTTCCGAAGAA
GATGCGCACGCATCCAGTCTTCTACGTTGGCTTACTCAAGCCGTA