Description :
From Genome Similarity Track
Location :
contig_47:266411- 268971
Transcript NameFunction/comments
g7870.t1hypothetical protein PHYSODRAFT_558953

Sequence
2560 bases(100 bases per row)
TACTTTGTTGATGTACTTGTTCGTGGTACTTCCGTTGATACACTTTCACAATTGTTGACCAGCTCCAGAAACTAATCGCCTATTGCCAGCGCGAATGCTC
GGGAACTGAAAGAGGCCGCGCTTCAGTTGCTTCGTGTTCGTTGCTTTTGCTCGTTTGAATCCGCTGCTTGCTGCTGTACTCTCTTATCAACCGGAGATTT
GACTGTTGCCGCTAATTTTTGCTTGCTATTATATAATAGCTGAGCGACGCATCCAGTACTCTGCGCCAAAGCACCTAGGCGGCATATACGAAGAGGCTGT
TGCGAATAGATACAGCAACCTCGTTCAATGATGGGTGCCAGCTAGTCTGCAGGATCTTCTTCGAGAAATCCAAAGCATCAGGGTCGCCTGGAGCGGGCAT
TGCAGCAATCTGCTGCGCGAGGCCTCGCTGGGGCATGGAGTGCCGGCGGCTCACTCGAGCTGTGCGCGGGGTGATCGAAATATCGGCGCGTCCATAACGG
TCATAAATATGGAACTCGCTGTTATACGAGCCCGTGATGAAGTTGTTGCCATCCCCGCTGACCCCGCACTCGAATTTGTCGAAAATGCAATCACTCTCAT
AAAGATCCCCCAGTCGTGGACGAAGGTGCTCGTGGATCTAGACGTAGGAACAAACACGGTTAGTAAGACCAGCAACACCAGATCACCCTACCAGCTTTCA
ACGCCAATGCCGAAGCAGATATTGCACGACTTACATTGATCGTTTGAACCGGACGCGAGTTCATGTTGATGTCCCAGACTTTGAGAGTCAGGAAGTCGCG
TGCAATAATGTAGCGGCCGTCAGGAGAAAACTTGATGTCAGAGATCGACGCGATGATCTCAGAGAAAAAACTTCTGGCTTCAGGATCCTCCTGCTCTTCG
AAAACTGTAGCCCCGTAAGAAGTGTTCCTTATTAGGCACGCTTCACCAGGCCAACAACACAAAAAGTGCATCAGGAACAGTGCGCACCTTGAGAGTACGC
ATCACACAACGCCGCCTGCCGCATATCGCCCAGCTTAATGGCGCCGCGACTCGTGCTATACATCATCGTGTTGCAGTGCGTCGGGTGGAAATCCGCAGCT
GTGATAACCTCCGTGAGCTCTTCCATATTTGCTGGCTTGATGTCCACGATGTCTAACAAAACAACACCACCAACGCACATAAGTTAGAAATGGCATTAGG
CGACAACAAAAGCGAGCATCGACGAACTGAAGCTTTGATTCGAGATGCCCAAGCTCCACAGATTCACACGAAGGTCATCCGCCGACATGAACGTCTCTCC
ATCGCTGTTGATCGCGATCGAGTTGATGTGATACGTATGTGCGTTCGCGTAGACGCGTTTGGCCGTGGACGTCGTCACCTGGCCGCGAACATTGGTCTGT
GGTAGGCGAATGAGCTCTGGTGTGATTTGGGCCCGTGGCACGTGAGCGAGTCCCTGTTCGTTGTACGTGGTGACTTCACGCACGCTTCGCTCGTGTACCT
TCCAGAGTTTGATAGTCTTGTCGTTTGTAGACAGGAGGCACTGGGACCCGTTGGACGGTCGGCACCATTTGATCTGGTTGATCTTTTCCTCGATCTCCAG
ACTTTTGAGGTAGTCGAATTCGGCATTATGGCTCTGGAACTCGGCGTACAGCTGATACTGCGGGTCGTTCATCCCGCTGTACATGGTTTGATTCTGATTT
GGACAACATACAATGTCAGAGGATAAGACCTGCAGGTAAACTCCATAAGAGCACGGACCGACGCAAGGTTTCCATGACGACAGTAAATGGAGACTCGGCC
GCCCTTGTTCCCTGTGGCTAGAAAGTCTCCCGATCGGTCGTACTCAATCGCGGAAATCACCTCGGCTGCAGAGTCATCATCTGCAGTCAATAACCCAGCA
CCCTGAAAGCTGTAACGCCACCGAATCCCTACCTTCAACGAAGCTCCGGGCGCTTTCGCCCGCGGAAAAGACCTGACCCCACTCGGCTTCAGCTTCGCCT
GTGGGTTCTGCCATGTTGACTTCCAAAGCGCCGGCGTTAGTGTGCTTGAGCCTGGTCAGCGCACCCACTCGGCCCTCTTCGCCTCCGATGTCTCCGTGGA
GATTGGTTTGCGTCATGCAGACGCGAGGGGGTTGGGAGCTGCTCTCGACACGACCGTCTGCTTGGCGCTGTAAGAAGCGAAGCTGGCCAACGGACTGCTG
CACCTGCTGCTTTCGCCTTGGGGGTCCTTTCTTCTTTCGCCGGAGGATCTCGAGGTGTTGCCTCAAAGGCCGCTTTGCTCCTCGGCTGGGGGTTTCGTTT
TTCACGCTAGCAGAAGGGCGGGCGCGACCACTTGGAGAATGGACGGACGAACGCAAGGCGAGGTCAGCACTCGAGGGCTGAAGCGACGACGGCGTCTGAA
GGATCTGCGGTGATGCAAATCCCGTTGTTGCCTGCTGGATGGAGTTGTCACGAGGCGACGAGCTCGAACGATGCGAATGGGGTCCCTCTCAACCGACCAG
ACGCTGACAGGCATCGCGATCTTCAATCGCATTTTTTTTCCATTTTTTGCTATGTACTGC