Description :
From Genome Similarity Track
Location :
Scaffold_1051:2664- 8260
Transcript NameFunction/comments
Phyag_g9273hypothetical protein

Sequence
5596 bases(100 bases per row)
GCCAGGTTGGAAACTGGTACGAGCCGAGCGTTCTGAGCTCTGCATCTTCGCCTACGTCGGAAAGCACACGGACCTGAAGGTTAATAAGCCGATCGACAAT
ACATTTGAACTGCATGGAGAACATACCTCTGCGATTGCAAGCCTGCGAGTGGATGAGTATGTTCGATCGAGCGTGGCAATGGAGCTGGACTTGTTGCCGG
GTGAATCGCGTGGCTACTGGAAATATCACGCCCCCGACAAGTGGTTCAAACAAGCCAAAGCGACCGCCAAGATCAACAACGAGAAGGCGACGTTACTCTT
CGACTCTGGCGCCGAAGTCTCTATTGTGGACACCTCTTTTGCTCGTAAAGTAGGCTGTACCATAGACGAAAGTCAGAGACAAGAATGCGTCGGAATTGGA
GAAAGCGCATACATGACGACGGGACGTACCAAGATCAAGATCACGCTGGCAGGATCTCTGGTGTACTACTTCGACGCTTGGGTTGGCTCGTTGTCAGGCC
AGGAAGCAATCCTGGGTATGGACTTTATGGTTCCGGCAGGAATCCGTCTCGACCTCGCGGACGGATCGCTGTGTCTCCCGGATGAGGTGCGGATTCAGCT
ATCgggacgacgacaactctACAGTAGTAGCGTTCGGCTGGTGACCGCCGACCAATACCTGGAAGTCCCGGTAGGCGAGTCGGTAGAAATAGTGACccgc
tccagcgcctcagATCGACAGACGTTATGGCTTACTCGTGGAGAGAGATGGGTGCCCACCGTCGTGAAAGTACTTGGACGATCGCAGTACCTGCGGATGA
CGAACGTGAGCGATCGTGGATTAACGCTGCACCGTGACACACTAGTGGGAATGTGGCTCACCGGAGATCGCGCACCCAGGCGTCCGGGTTTTGTGTCGCC
AGGATCGCGTAGGTATGCCGAGTGGCAAAATCTAGCGTACCAAGCGACGACCGAGAGATCGGGAGAGCTAGAGTCGGACGAACCGCCTACCGGGCCAAAG
GTAGATCGGCCCAGATACGACACTCCGACCAGGATATTGACGCACCAACCCGATCGCTCAGGACGAAGGATTACTACGGTGGCACCACATCCCACGACTG
GGAAGGGCTCGATAGAGAAATCGTCCGAGCCGAAATGTGCTATCCAAGAGGAGTCTGGAAACCCCATCGAGGGAGACTCAGCTAAGGAGGAACAGAAACC
GATCCCACCCAAAGGCCCGATCGATCTGAGGAATTCCCCGACAGGTGCGCCGAGTGTGGGACTTGCGCCGCCCCCGCCGGAGTCCGAAACCCAGGGAGAG
GATCAGATCTGCTACCACGAGGGCGGTGATTTAGCTGTTGAGGACCTGGAGAAACAGGGGGCGATCCTCCTGGAAGTGGTAGCCACCACAGACGAAGTCA
CGATCGAGGATATCCAAGTTGGCGATCCTTCCCAGGACGCTCCTGAGGACATAGAGCGGTTGCGCCAGATCATCTGGAGCAAGCGCCACCTCTTGATCGG
AAAAGGAAACGCCCTACCCCCGGCGGCCCGCGGTGCGATTTGCGATATCGATGTGGGAGGCGCGGCCCCAGTGGCGCAGCGTGTACGAAGAGTAGCTCCA
CAGTTCCGCGAAAAGTTTTCTGATCTGATCAAGGGACTGTTGTCCGCGAAGATCATCAAACATTCGACCTCTCCGTGGGCATCGCCGGTGGTGATCATCA
TAAAAAAGAATGGGGTCGACATCCGCCTCTGCATAGACTACCGGTTGGTGAACAGTCTGACCAAGCTGATGGTATACCCCATGCCGCTGATTAGCGATCT
CCTGGAGGACTTGGACAAGGCACTCTGGTATTGTTCACTAGATATGGCCAGCGGATTCTGGGTCGTCTCCATGACAGAGCGTGCTCGGCTGATCTCCGCG
TTCATCACACCTTTCGGGCTGTTCGAGTGGACGCGGATGCCGTTCGGCCTGAAAAACGCACCCCAGATCTATCAACGCTTGATCGATAACGCGCTGTATG
GGCACCTCCGGATCGGCCCCATTCAGGATCAGACGCGTCCGATCGACGTGTTCAAGGATGGTGAGCCGGAAACGGATCAGAGGCCGTCGGTATTGGGAAG
GCGATCATACATCGATGATATCTTGATCACGGCTCCCACGTGGGATGCCATGTGTAGAAAGGTAGGAGACCTGCTGGATGCTTGTGATCGATGGAATCTG
TCGATCAGCGTTGTCAAGAGTTTCTGGGGACGCCGCAAGGTGGACTACCTGGGCCACCAGGTGTCAGCCGATGGTCTAGCGGCCAATCCGAAGGATCTGG
AGTCTCTGAACAACCTGCCATTCCCTTGTACGCTGCGGTCGATGCAATCCTTCCTGGGAAGCTTGAACTACTATAGCCGTTTCATCGAGGATTTCGCAAT
ATATGCGGCGATCCTGCATGAATTGCGGGAGTCGGACTTCCATGAAATTCGCAGTCGAGAAGAGACAGGAGATCGACAAGTAACTGGGacgaagcaccac
cagccagTGAGGATGACCGATGGGCGAAAGCCAGGACcgccttcgacttgctgaagacgaagattGTGTCGACTCCGATCCTACGACACTTCGATCCAGA
TCGAGTTCCGGTGATTGTGGTGTATGCTAGTAAGTGGGCAATCTCCGCGGCACTTCTGCAGGAGCACGATGGCGTGTACTGGCCAGTAACCTTCACCAGT
CGAACCTTGAAAGCGAACGAGATCAACTACGGCATCGTGGACAAGGAGGTGCTTGCACTTCTGCGCATCTTGGATGTCTGCTACACAATCTTGGTCGGGA
GATCGATCGTCGTCCTCTCAAGACACTCCACGCTAGCGTGGTTAATAAATTCCGCTGGTCTGGATGGGAGACTGGGCAGATGGGCCGCTCTGTTGTCGGA
GTGGTCACTGGAGATCAGGAAGTGTACGAAGGGCGAGGATGAAGTACTGGGGACGATGGCCGCGAGCATCACGCCCCGTGCCGAAGTCGACGAAGCGCTG
ACAGCGATCGCaccgaagaagcagccgcGTCAGACTATCACCATGCCCCCACCGACGGTAGAGCCCGACGAGGGCCTCCTCGTCGCTAACTTTGACGGGT
CCGCACGAGTGAAgcgaggcggcggcgcctACAGCGCGATAGTCTGGAAACTCCCGGAGTGGACGATCGTGGCGGCTGCCTCGGGTTACGCAGCCGATCT
GACCGTGAATGAGGCAGAATATAATAGATTGCTTCTCTGCTTCGATCTCCTAACGAAGAACGCGGACAGGGGACGGGTCGTGATCTGCGGAGACTCCAAT
CTGGTGATCAGACAGATGCGCGGCGAGATAGAATGCAAGGCCCCGGGCTTGCGGCTGTTGCGGCAGAAGGCGATGGATCGACTGCGCTCCTGGCCAACCC
ATGATTTCCTGCACGTGAAGCGAGATTGGAACCAAAGCGCAGATCGGTTAGCAAGTGCGGCGCTTCAAAGGCAGGAAGGTGCAGTGATTACctcggacga
agagctgcaagatcTGATCACGCTGAATCGACTGAGCGAGTTGCTCAAGCCGAAGACATCGGAAGCTGTGGTCTACGTGACCGCCGTCACTAGATCGGCG
ACGCAGAAACGACACCGGCCGGAAGTGTTGCAAGAGGAGGTCGTCCGACGACTGCGAAGCGAGCGCATACGTCAAGcacaagacgaagaaaagTGGATCA
TCAATCTGAAGTCGTACCTGAACGGATCTGTAGAGAACTTGACGGCGGACGAAGCCAAGTCCTGTCGGAAGATCGCCGCCGATtacgaggtggacgaagc
cGATCTGCTTTTCTTCTGTCCcgactcctcctccttaGACGCCGATCGCGATCTGGTTGCCCGACTCGTGATACCGGAgactctgcagcaggacATCCTA
CATCATTACCACGCTAGCCTCGAAGGAGGACACCAAGGGATCGGCCGGACGTACCAGAGAATTAGATCGCACTTCCACTGGCGTGGGATATACCGAAGTG
TCCAGCGCTATGTGGGAGAGTGCGCAGACTGTGAGACGGGAAAAGGGCGACCCTACCTGCAGGGCAGATCCCCAGGGAACATGCGAGCCACGTACCCCTT
TCAGATAGTGGCGATGGACCATGTACCGTCGCTGCCGAAGTCTTTCAAAGGGAACACGGAGCTTCTCATTTGGGTCGACCTGTTTTCCGGCTACGTGATC
GCCAAGGCGAGCAATTCTCGGACGGCCCAAACGGTCGCCGAGAATTACGAAGAGTGCGTCTTTAGACGCTTCGGCGCAAGCGAGGCCCTTCGACATGATC
GTGAACCTGGATTCATGGCTGATTTCTTCCGGGCATTCAACCGGATAGTGGGACAAAAACAGCGGGCCACGATGGCCTATCGCCCGCAGGCCAACGGAAC
AGCTGAAAGGATGGTGCAAACGATGACCCGGGCACTCAAGATGTATGTCGCAGACGTAAATCAGCAAGATTGGGACGAGTACGCGGAGCGCTTGACCTTC
GCGATCAACACGGCGCACGATCGCGTCCGAGGAGACACCCCGTTTTATCTGATTCACGGCTGGGATCCACGTACGACGTTGGAAGCCGCGCTGCCGCTGG
GCAGCACGCGCCGTCGAGACGTCGAAGCCCGGCGATGGAGGTATCACGTGCAGAAACAGTACCAACACGTGAGGGAACGAGTCAAAGAACGCCTGCGTGA
AGCTATTCGAGACCGAGCTGATCGGCACAACGAAGGCGTGAGACCACACAAGATCGAAGTCGGTATACAAGTTTGGCTATATTTAGACAGGGTGAAGGAA
GGCTACGCGAGGAAGTTAGCCCACATGTGGCATGGCCCGTTTCGAGTAGCTGAGCTCGTGGGAGAATACGCAGCCCGCCTTGAGACCGCGGGTACCGAGT
ACCGACTCTTCCCCGTGGTGCACctgtccaagttgaagcctGTCCGAGTCTTCCCTGACCGCCCGGAAACTGACCTGACGgtgaatgaagaagatcgctt
CGATTTTGATGAGGCCTTGCTGCCGGAAGATAGTTGGGAGGGTGTCCGAGGGGAAGACGAGTACGAAGTGGAGCGAATCGTAGACATGCGTACCGGACGC
CGTACTCGCTACGGCCGAACCCATCGCGAATTCAAGGTCTACTGGAAGGGATGCGAAGAGCCATCCTGGGTCGATGAGGCGGATCTAAATTGCGGGGCCC
TGTTGCGCGAGTACGAGCGcgcgatggtggcgaagaATCGCTTCAGAATGATGCAGTCCCATGAGGAGGAGACGCAAGATCCGTAGTAGGCTGGCTACTA
TGGAAAGGGGTGTAGTGTGACGAGTGCACAGGGTGGCTATGCACTGAGGAGGAAGGGCTGTGTATGTGGAGTAACGATCGAGCGTGGCCACACCTCGATC
ATGTGCGGGTGGACTACGCTCGATTAAAAGAAGAAAGGAAGATGAACAAGAACGACTGGTGAACCAAGAACAAGTTGACCGAAGCGACGGACTCGTGGAG
GCAAAGATAACACGAACCAAGCTGACATTGCGATATGCAGTTGCGAGCAGAAAACCTGTGCTAGCCTACGATCTGGAGGCGCTAGCTCACTCTGGA