Description :
From Genome Similarity Track
Location :
Scaffold_2:26633- 28651
Transcript NameFunction/comments
Physo_297105Hypothetical protein
Physo_487961chemotaxis protein CheY

Sequence
2018 bases(100 bases per row)
GTCAATACCAATTGCCTCTTGCAGCAGTTTGCCTTCGGAGGCTACGGTCTCGTCAAGACCAGCTTCATCATCATATCCGACAGCGTCAAGTGTCGCGATG
CCCAAGCGGGCGTGGACGATGTCCATTCGATCCCGCATGGGCATCCGTTTAATGAGCACGGCGTTAACGTTGTCAACGTTGGCGAGTTTGTTGAGCGACT
CTGTCTTCCTCTGGCAGCACAGAATTCACCGAGTCCTTCCGGGCATACGAGTCTGATGCCGACGCTGCGTAGCTGGGATCCCCTTCTGCTCTCCATTTAG
GGCCTGGTCGGGGAATAATCGTCTCAGTCTCGCTCGTCTCCGGTAAGCCTACCCCTAAGGTGAACCGAGCCGATTTGGTCGGTTGGCTGGAGACCGTCTT
AGTTTTGGTGTGTCAAGCCGCTCGACTCATCACCATCACACTCGAGAACTCGCAGCCATGGAACGCACCCTTACTGCTCCACCTGTGGGCGGCGCTGAAG
CTGAAGACGCTGCTGAGAGAAGCGTAAGCGGCACGGACCCCAACGGGAGCGGCGTCGAGAGAGCACCCGGAGGCCGTGGTGGTCGCGGGGCAGGTCGCGG
TAGTCGTGGAGGACGAGGAGATTCGACCAGGCCAGCTGCATCATGGAGCGATGATGATGTGAGCGAGTTCTTTCGCCTCCGTTACGCAGAGTTAGCTGAC
AACTTCAAGAACCCGAAGGACACCAAGCGCATCAAATATGCGTGGGCCGTCTTAGCATCAACACTCTCTGTTAACCAGAGCAAAGTGTTCACTGACCAGC
AGTGTCAATCTAAGGTAAATATCTACAATGTGAAAATATATATCGGAATGAGCCACTACTAAGTTATTAATCATGATGTGCGGTGAATATTTTTTAAAGA
TGAAGAACATGAAGCAAAAGTGGGCGACTGCGCGGGAAGCAGAAGGTCGAACTGGCAACGACGGACCCGTGCGGCGCCCAAATCACTACTCCATCATGAA
AGACTACTGGGGTGATGCGACGCGGATGAACAACCGACCGCATATTAGCACGGAGGACCCGGATACAACTGCTGCTGCTGGTGACGCTGCGAGCGCCGAC
GTCGCTGCCTTCGTCACGCCTGCCTCACCTCCCCCTCCTCAATCTCCAACGCCCCGCACCATGTCTGGCTCCACGGGGTCGTCTAATAAGCGACAGAAGC
GCACCCAGGGGGGGCGTGTGGAGGCGGGTTTGAGTGCGGTTGCTAAAGGGTTTAGCGAAGGGCTAGAAGCTTTGGGCCAAGGACTTGCTACAGTCCGAAA
TGGGGGTGCCGAAGACATTGCAGCTGCTGTGCAGCAACAGACCGGGCTGTTCCGCGAGCAAAGTGAGCGGGCTCATGCCCAAACCGAGCAACTCTTGTCG
GAAATGCAAGCTCAGAGCGAGCGACTTCGAGTGCAGAATGAAACGATTCGAGAGCTACTGGATTTGATCCGCCGCGACCATTAAAATCTAGCTACACACG
TTTTCTAGACTAGCTCAAAAGCTTCGGTAAAAGCCAAAATGGACTCACGTTTTCTCGAACCAACATCTCTTAGAAAGCTTGCAGTCATCTCAGAGTTGTT
CCCAGTTACAACAAAATCTTCCTCTTCATCGAAGTTCACCCGCGCGTCATCTTCATCTTCGAAAGAAGTGTCATCCTTCAAACCCAACAAAATATTGTGG
AGAACCATCGTTGCAGCCACAATATCCACAGCCTTCTCGACGCATTTGGTGTTAATGCAGCAGTTAACAATTCTGAAGCGACCTTTCCAGAGTCCAAAAG
CACACTCGACTGTCATCCTAGTTCGGGAATGCAGATAATTGTAGCGTAGCTGCTTGCGTGTCAAACCGGCTCCATCATTTTCCATGAACGGCGTCATGAT
AGCCGGACTAATAGCATATCCTGCATATCCTAAAATGTGGGTCCCCGCTGGCAAAAAGTCTTTGAAGTTGGAGCCTAAAGTAGACGCACGCCATGTTTTT
TGGTCAGACCACGAGCCC