Description :
From Genome Similarity Track
Location :
Scaffold_255:26632- 28688
Sequence
2056 bases(100 bases per row)
TGTCGGTCGTTGTTTGCACGCTGCCTTGGTGTACAGCCACTCACAATTCAGCGCTACATGCGTCGTGTCCGGGAAGGTAATATTGCGGTCAAAACGCATG
GTACCCAGCATAAAACCCATCGACAGTCGACGCAGTTTAGCTTGTGAAATGTTTAAGGAGTTTGCAGCTGAGGTCGGCGAGGTGGTGTTGGTGAGAGTCT
GCATGCAGAAAACCAAGGACGGGATGTTGAAGAAGTATTAGAGCCGTGAAGATTACATCATGTTACCTGCGACGCTTACGTGGGAAGCAATCTATGACGA
GATGAACAAGTTCGTGAATATTAAACTCCGCGTTAACGAGCCTGCACACTCAATCAtccacaagctgctgtcaCGCTACTGCCCCAACATCAAAATCCGG
GCTGCGCCGTCGAATGTGTACTATTCACCAGGCTCGCATGCGTCGTGGTGCGTCCGCCGAACAAACGGAAGAACTGGGCCAGCACACGGAGTCTGCGCGT
CAAATGATGTACGTGGATATAAGTATCATAGTGATTTATCATGGGTTTCTAACTTCGACATCGATATCATTTGGATCTGTTGGAAACATGTAGGCGTGAG
TACAAGAAGGATACATCCACAGTACAGTCAGAGGAGGACAATGGCAGCGACATGGCATTGACTGTCATGGTCTTCTCGCAAAATCTTACGATTCTGTCGG
TTACCACCACACCGTCGCAGTGATATTTCTATTTAATGCTGGCTGTGAATGTCTTTCGCATTTACTACGAGACCGAGGGGGTCCAAACCCCAACTATGTG
TACGACGATTTTGCAAGTGGAAAGGACTGCGACCAGATTAACTCGATTCTGCAGCACTTCATTCGTACCGTGCTACTGTCTGTCGGTAAAAAAACACGTC
GTCATCTACGCAGACAAATGTTCAAGGCAATCTAGAACAACCACGTGATCAAGTTCTTCCTGGTCCAAGTGCAGAGGGGCACTCAAGAACGAGTCGACTA
CAATTTTATTTTCACGGGGAACACGAAAAGTTCTTGTGATTGCGGTTTCGGTTATATTTGCAAGTACATGGGTCGTGCGGACTGCTGTAATATGGATTAA
ATTGTTGCCGCTGTTAACGGTTCCTCTACCACTAACACTACGGTGCACACCGCACGTGGGAACAACTTTTTCGAGAGCTGCAAATCACTAGTGACAGAGC
TGTACAAGACATTGGTGGGGGTCCAGCAGTATAAGATTTTTAGCATGGAAACCCGGTGTAGTCAAGTGCAGAAAAGGTCATGGGGATGAGCCTGTCAAGC
AAGATTTTCGACGCCAAGTAGACGGCGTCTTGGCCGAGACTGACGAGGTGACTAGCATGTTCACGCATTTTCTGGAAGACCTGAGCCCTCCTTCACTAAA
CGCCGAGAAAATGTTGGAATTGCACAGCAAGATCCGCAAATAAGTACCTGATGAATTCCAGGACGAAGCGATCTACGACGCCCCAGGAAAGTGATGCTCA
AGCAGCTATGTAAGATCGCAGagagcgccgtgctgctATGGCTAAGGCTGCGAAGGAGAACAGCGACCGCCATGGGAGAGACATCAGCAGTGATACTACA
GTGACTAAGAAGAGAAAAGGGAACGACTCGCAGGCTGCGGTAGTTTAGGTCCGCAATTTGGATACAAGAACTGGTGCGTAGTATTTAATATTTCATTGTG
ATACTTGCCTCCACTGCCAAGTCGAAATGATACTTAAGGTAAAGGGGTGTCGCTATTGTGAGTGATGACGAAACAACATCGTTTTTGAGGATGTTGCACT
TTGGCGTACCAACGACGCATAGTACTATTCGAATCGCACGCAAATGTTACCCGTAGAGAACGTAAAACATTTTATTTTTAATTTTCGCTTTGTGAAGGAG
GGGTGTTTTTAGAACCCGCACCTTCGTATGTTTCGACTTCTAGAAGGCATAAGGGGTCTCAAACGGAAGGCGAGATGCCATTTTTTACGGTGGTATGCCT
AAATCACGATTCACACTTAGGTTCATAAGTGTTTTTGTTTGACGCTGTCTCATATG