Description :
From Genome Similarity Track
Location :
contig_54:266308- 268166
Transcript NameFunction/comments
g9162.t1hypothetical protein

Sequence
1858 bases(100 bases per row)
CCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGATCGGAGACAGCCTCATCCCGCGCTGTCTCTGGTGGAGGGCCGCATGCACCACGTGGTGCAT
GCATGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGTGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGT
GCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCTAGTTCTAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATACGAGAAGCGTACGC
GTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAG
GCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGC
TTGTCATCTTCTTGCAGTGAAATTGACTCTCGCTGGGGGCAGCGATCTTCAATGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCG
CCCCGCGCCTGCTGTCCCTTTAGTTTTTTATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCTCACCGCGTGCACAGGTGCTGTGCACTCGCGGG
CATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATACACGACGCTGCTGGGAACCAGCAGCGTCGCACTCGAGAGGTCCATTGGTTCG
GGACCTCCCGACGGCCGTACCACCGGTCGTGGTATCAGCCGCGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAGCG
CAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCATCTCTAAGGCCTTTCATAAACGTGACGACCTTTGTCGCCTCGTCAATCGGGT
TGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGGTCGAGGAACTCCGCCCTCGATCGGAA
CTCGTTCTGTGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGGTCCATGAGTCGGCGTCCGTCCGCCCAA
CTCCTTGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCC
AACGGAGGAGAGGTCCCCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCCCGCGCGGTGTGACGGATGGCCGACACCGAAGCTCGAG
CAGTGGATTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTTCGCAACATCGTTGCTACCGCCGTTTCTCC
AATGACCGTCGACTGTCGTTGGAGGGCCCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCATGCACAACATGCGTTGCAGACGTGTTTCGGCTACCCA
CGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTCTTAGTCGGTCGTTGGACGGACCAACAAGTGCTACCA
GGTGTAATGGGTCTGCTTAGACCCACTACTTTAGCTTACACGTGTGCGCACGTGTATGAGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTAT
CCACAAGTATACTTAAACTAAGACAAAGGAACGAACAATAGCTTTGGTGCCAATGAGA