Description :
From Genome Similarity Track
Location :
contig_62:2663- 7384
Transcript NameFunction/comments
g10890.t1hypothetical protein

Sequence
4721 bases(100 bases per row)
CTGCAGACTTACTGGGAGAGCACACACTCTTTCCCGATCTCGAAGGCTAAGTGTTCGGCCAACCCGTGGTTGGCTCGCTATCGCAAGAGTCGTAGTAATC
GGCGCGGTCACGCGGGAACTCGCTGGAAGCATGTACTCTGGCTCCTGATCTTGGCTATGCGGGATGGTTGGTGTGATCTAGATGTGCTACTGGACATTTA
CTTCCTTCACTTCCCCACCAGATCTGAGAAGGTCACGTGGTACCTGGGGTCGTTTCACGCCTCGCGAAGCTGGCTAATCCTCTGGTATCACAGGACGAGC
CGACAACACTCCTGGAGGCCCTCGATGAATGCAACGAGGCAGATCCTTGGCGCAATCATTTTCGTGATTCCCCTCAAGATCACCCGGCGTACCGCCTTAC
CCGCATCGCGGGCAAATTCCTCGGTGTGCATCCTGCTACACCAGCTACTCCGTGATTCCTGCGGAAGCGTGACGCGCCAGCTCAGGTAGTTCTTCCGTCT
CTTGATTAGCCGCTCCTTCATATTGCTTTCCCAATTCACCGATTTCAGATCCCGATCCGGGGCTGTCACCACTTATTCTTCGTCGATTGCATACTCATAT
GTTTACATACATCCCACTCCTCCAAAACTGCAGCCTTCCTGCAGTTCCTTCTTCAATTTCCCCCCGGCGTGGCCAACCCACACCAACGAGTCCCGCCTCA
CTATTCTTCCTGAGACTGCATCACACCAAATCGGTTGTGATTCGCGCGATCCCGTAGGAACTCATGTAACAACGCACCACAGTTGAGATCCGCTTCATCG
ATCCAGCTGGGCTCCTCATATCCACGCCAGTGTACTAAGAATTCACGATAGATCCGTCCATATCTCGTACGTTTGCCGGACCTCAGATCCGTGATCATCT
CGACTTCGTTTTCATCGGATCCAAGATCCGAGATCCAACTATCTTCCGGTAATAGCGCTTCATCGAAATCTAGCCGATCTACATTGTCCACAACCAGCTG
AACGAGCGGGCGATCTGGGAATTCCTTCACCAACTTCAATTTCGATACATGTACCACCGGGAACAAACGGTAATCCGTTCCGGCAGTTTCGAGCTTGACC
GCGTACTCATGGATTTTCTCTGCCACTCGAAATGGCCCGTGCCACAAGTGCGCCAACTTACGGGCGTAACCTTCTTTCACGCGATCCAGGTATAGCCAGA
CGCGAGATCCAGCTTCTATCGGGTGGGGTCGGACGTCGTCATTGTGCGAATCTGCTCGATCTGCGATCGCCTCACGGAGCTTTTCGTTGACTTGTTCACA
GACCCGCGTATAATAACGCTGGATCCGGTAGCGCCATCGGCGTGGATCACGATCTTGACGTCGGGTACTACCCACCGGGATCGTGGCCTCTAATGTAGAT
CTAGGATCCCACCCATGTACCAAATAGAAAGGCGTATCACCTCGGATCCGATCTTGGGCTGTGTTAAGGGCAAACGTAAGCCGCTCGGCGTACTCGTCCC
AATCCTGTTGATCCAGATCCTGGACATGCATCTTGAGTGCGCGCGTGATCGTTTGAACCATGCGCTCCGCCGTCCCATTTGCTTGCGGTCGGTAAGCCAT
AGTGGCCCTCTGACGCTGTCCTAGGATCTTGTTGAACGCTCGGAAGAAGTCGGACATAAATCCTGGTTCCCGATCGTGCCGAATTACCTCGCTTGCGCCA
AATCGGCGGAACACACATTCTTCGTAGGATTCCGCTATCGTTTGAGCCGTCCTGGATGAGCTGGCCTTGGCCATCACATAGCCAGTGAACAGATCAACCC
AGATCAGCAACTCCGTGTTGCCTCTATGCGATTTCGGCAGCGAAGGTATGTGATCCATGGCTATGATCTGGAACGGATAGGTGCCTGGATATTCCCTGGT
GACTCGCCTCGGATAGTGGGCCGACCTTTTCCGGTCTCGCAGTCTACACATTCCCCAACATACCGTTGGACACTCCGGTACAGGCCTCTCCAGTGGAAGT
GATCTCGGATCCGCTGGTAAGTGCGGCCGATCCCTTGGTGGCCTCCCTCTACACTAGCATGGTAGTGGTGCAGGATATCCTGATGGAGGGTTTCGGGTGC
AACCAACCGCATCGCGAGATCTCGATCTTCGTCAGACTTCCGGTTTGGTGGACAGTAGAAGAGTAATCCGTCCAGATCCATCTCGTAATCCATTGCCAGA
TTGCTGTAGGATCGATCTTCTTCCTGGGTCCAAGTAGCTACATCGCCAGCCAGATACTTCTTCATTCCGGCGATCCATGACTCTTCATCTTGGGCCCGAC
GAATTCGCTCTATCCTGAGCTCCCTCACCAATTCTTCCTGCATTACCTTCGGACTAGATCCGGATCTGACTCCAGATCGGGTGTCACCGGCGAAACTCGG
ACCACGGATTCTTCGGACTGTACGGTTAGAATCTCGTCCAACCGGTTTAGGGTCACCAAATCCGGATAGTCTTCCTCGTCCACTAGGATCCCGGACTGTC
GCTGAAGGGCAGCTCCGGCGAGGCTGTCAGCGGAACCATTCCAGTCTCGCTTAACATGTAGCAGTTCGTGATCTGGCCACTCTCGCACTCGATCTAGAGC
TTTCTGTTTCAACAGAACCAAACCTGGGGCCTTACAATCAATTTCCCCTCTCACTTGCCGGATCACCAGTTGGAATCCCCGCAGATCACTAGACGTCCAC
GCTCCACTTCAGCCAGGAGGTCGAAACACAACAAGAGACCATTATACTCCGCTTCATTCACCGTCATCCCTTCTGCATAACCCGATCGGGCTTTCAGCAC
GGTCCATTCTGGTAGTTTCCACAGGATCGCGCTGTACGCGCCTCCTCCTCGTTTTACTCGGGCCGATCCGTCAAAGCTTACCACGTACAATTCTTCATCA
GCCTTCACCGTGGGTACAGGAGCTTGGATCTGCCGTCGGGGCTCTTTCTTAGGCGCGATCGCGATCAACGCCTCTTCCACATCGGACCTAGGTGTAATAC
TGGCAGCCATCGCCCCTAGGATTTCGTCTTCCCTTTGGTGCACTTCATAATTTCAAGTGTCCATGGCGACAGAAGAGCTGCCCATTGACCCAGACGTCCC
TGTAGCCCCGGCGATCGGAACAACCATGCTAACGTCGAATGTCGAGTTAGGATCCGGATCTCACGTCCTACCAGAAGGTTGTAATTCAGATCCAAGATCC
GTAGCAACGCCAACACTTCCTTCTCGACCACATTATAATTCAGCTCGTTCGACTTCAGTGTCCGACTGGCGAAAGTGACCGGATAGTAGATCTGATCGTG
ACTCTGCATCAAGGCGGCGGAAATAGCCCATTCGCTAGCGAAGACAACTACTACTGGGAGTAAATCGGGATCGAAGTGGCGCAGAATTGGAGCGGTGGCG
ATCTTGTCCTTCAACGCTGCAAACGACCTATATGCTCTGACCCATCTCTCGTCAGCTGCATCTACACCTGACATTACCGGGGTTGCAGTAGTTGAGTGGG
AGATCTCGGGGTCGGGTTCAGACGAACTGTGATCCAGGATCCGACGAAGATCTGGGCGCTTCTTCAACTCAGCGAACTCCACTTCGCGCAATTCATATAG
AACGGCAGCATAGATCGCATAGTCCTCAATAAATCGGCTGTAATAGTTCAGGCTGCCCAAAAACGACTGCATGGATCTGAGTGATCCCGGAAAAGGTAGA
TCCGTCAAAGTCTTCAAGTCCTTCGGATTAGCTTCAATGCCATCGTCGGACACTCGGTGTCCCAAGTATTCCACCCGGGGAAGACCCCAGAAACTCTTCA
CCACACTTATAGACAGGTTCCATTTATCACACGCTTCGAGCAGATTCTCCACTCGGTGGCACAGTTGATCCCAAGATCCAGCTGTTACCAGGATGTCATC
GATGTAGGATCTGCGTCCTAACACTGACGGACGACCTGGATCTTCCGGTTCTCCAGCCTCAAAGGGATCTGGAGCAAGTCCTGGCTCGTCAGTAGGCGGG
ATCCGTGTAAACCCATATAACGCATTATCCAGAAGCCGCTGATAGATCTGAGGCGCATTCTTGAGTCCGAAAGGCATCCGGTTCCACTCGAACAAGCCGA
ATGGAGTTATGAAAGCCGAGATCGCGCGAGCTCGGTCCGTCATAGGTACGACCCAAACTCCGCTTGCCATGTCCAGCGAACAGTACCACGACACCTTGTT
CAGATCCTCTAATAGATCATTGATCAGAGGAATGGGGTAGATCATTAGTCGAGTGAGGCCATTCACCAGTCGGTAGTCTATACACAGCCTGATGTCGATC
CCGTTCTTTTTGATGATCACCACGATCGGTGATGCCCACGGCGATGTCGAATGTCGAATCATCTTTGCTGACAGCAACCCCTTGATCAGATCTGACACCT
TCTCCCGGAACTGCGGTGCTATCTTCCGCACCCGTTGCACGATCGGCTTAGCACCTCCTACATCGATATCACATACGACTCCTCGAGCAGCTGGCGGTAA
GGCATTACCTTTGCCTATCAACAAGTGTCGTTTCCGCCAGATGATCTGCCGCAGACGATCGATCTCATCTGGAGTGCTGCGATCTGGATCACCCACCTGG
ATATCGTCAATAGTCACTTCGCTCGTCATAGCCGTGATCTCTGGCAATACTGCCATCTCGCCTTCCACATCTTCAGCTAGCAGATCACCAGCTTCGTGGT
GATAAATATGTTCATCTTCCA