Description :
From Genome Similarity Track
Location :
Scaffold_1909:2663- 3677
Transcript NameFunction/comments
Phyag_g11723elicitin-like protein INL3a

Sequence
1014 bases(100 bases per row)
GTTTTCAAGCGTCTGTAGCTTCTTCATATGGCTGTCTGAGGAGCCACGGACACATTACGCTCTATGCATACGGTTACGTGCACCTCTACGGATGCTAATA
ACTTACACGTGGTTCCTTCTTACATCTATTGACTTGCGGTAGCGTTTCCTGTGAATTCGTAGCTTTACTACTGTACTGGTCCATTGCACAATGTCGTCTG
TGTGACAGCGAGGAGCGGAGGTATCTGCCGATGGTTGCGTACGAGGCCACTGCGTACACACACTGTGTTGCGTTTTCCTTGACCGGTCTCTAATTTCAGG
ATTCCTCTCCACAATCCATGTTTTCAGTAGGTCGGTATGTGGAGACCCACATGGTAAGTCCTAGACGGTCACTCTCCCTCTCCTGTGGTAAGATAACATC
AAGCCTACTCGTTTAACACGAGACGCCGAATTCTGCATTCCTCGATTCGTCTCGGACAGCGCAATCCTGTCCTGTCGATTTACCAGTCACGATGCCTTCC
CTGACTTCGTTCATCCTCATCGGCCTCGCCCTCGCTGGGACTGCCACCGCTGAAGACTGCCCCACAGAAGCCCTCCTGAGCCTCGCAAGCAACACGAACC
TTGCAAGCTGCACAGCTGCAACGGGTGTCAGCGTTTCGACCATCTCGACCctgaccaagaagcagatcgAGGATATTTGCAAGAGTTCCGCCTGCTTGAC
GCTTATGGACGATGTGGCTGCGATGAAGCTTGGAGACTGCACCATTCCAGGGTCGAACGTTTCAGTACAGACGGATGtcctggacgtggtggccaaaAAC
TGCGCGGGTAGCGGGTTGAAGGGAACGACGGATTCGACAGGATCGATGAGGTCATCGGGATCCTCTTCGACTGATGGTGGCACCAATAATGTCGGCGATG
AGTCGAGTGCTAGCAGTGACAAAGTTACcggcagtagcagctccaagagcggcgctgcagctctgaCTGTTGGTCTCAGCTCGGCCATCGCTGTCGCGAC
TGCTGCTATGCTGC