Description :
From Genome Similarity Track
Location :
Scaffold_33:266294- 279447
Transcript NameFunction/comments
Phyci_221954Hypothetical protein
Phyci_6406Hypothetical protein
Phyci_221893Hypothetical protein
Phyci_222081Hypothetical protein
Phyci_222093Hypothetical protein

Sequence
13153 bases(100 bases per row)
TGTCGGCCTGGTAACGCGCCATCGCGCTGTCCGTAGCGTACGGGTTGAATATATAAATCAAGTCTCGGTGATCAGTGTAGAGGTGAAACCCTTTAGGTCT
GAGCAGGAGATACTCCAGGCGACGTGTTGCCTCGACGATAGCGCACGCCTCCTTTTCGATCGTCGGCCAGTGGGCTGCAGCACCCACAAATCTTCCACCC
AGGAAAGCCAGAGGTCGATGCTGCTGCTCTTCCAGCGGCAGCTGCAACTTGTCCGTCTCTAGCTAAGTGACGACCGCCCCCCAAAATGCATGGCTTGCAT
CGGAGTACAAGCAAATTTCCGACGTTGGGCTCGGATGTGCCAACAGTACCATATGCAACAACGCATTACGGACGTTGTCGAAACTAGCCTCCTCTTTCAC
GCCCCAGCCAACGCTGCTCAAGCGGATCTTCGCCAGCGCTCGTTTCTTGCGCGAGCCGGCAATCTGGGCTGCGCGATCAAGCACCTCGTACAACGTGGCA
GTCAGACACGTGTATTCGGAAatgctctgacgcatccaattaatggcacagagatactgctgcagctcagctcctgtctttggtggctgcatgcccacga
gaccttgcacacgctccggtcaatacttcacaccctgcgccgatatgacgcgaccacaccacgtaacttctttcgtgaagaactggcattttttagcatg
cagtttcagtccatactcctcacagcgtgctaacacctttgcgagcaattttaacaacttctcctcatcctctacataaccaaggatatcatcgagccac
gccagaattcCATCACCTACGCGTTGCCACTTGCAGTCTGCACACGCGTTGCAGCGCGCTCGGGTCTCCAGTAGCGTCTACAGGTCCCGCCTCACCGACT
TCCCACTCCGCACTAGTGTCTCTTGCCTTGACTAGCAGCCGATCCGTTAAATAACCCAAAATTTTTATTATCGGTCGACCCACAGTCAGTCCCAACGAGC
TGTCACCATCTTCGACATAGCACATCAGCTTACGTAACATCAGCGGACCTAATGAAGTGGTGAGCACGACCTCGCGGAAGTCGCCTGCCTGGCAACGTCG
ATAGCATGCCCCCCGACAGGGTCTAGCTGGACCGAACTGACGGCCTGGAGATCCACAGTCGCACccgcgtctacgagcgcgtcgataactcctcgggcca
caagcgacgtgtctgCTCCCGAGTCCAACAAGAGCGCCTTGACGGCGAGGCCCTCAACCGTCGCATCAACAGTGCCATTATCGGCAAGCATGTCGCCGCC
GAGATGATGCTTCTCCTCACCTCCCACCGTATCAAACCTCTGTGCTGTTAAGCTTTGGACCGGCTCATGATGCTCACACCTTGCCTTCAGCAGCTGCGCA
GCCTCGCCTGGCTGGCAGTTCGGACACTCGCGAACCTGGTGTTGCGTGGAGCCACATTTCAAGCATGCTCCACGTACACGCCGCGAAGCCGTATTGGCCA
CGGGCGGCACTTGCGGTCCTGCCGAGCCGGGAGCCACCATTTGGCCCCGTTGTTGATTTTCCTGTCGACCGCGAAATGACTGTCCTCCTCGACCGCCGTT
CTGTCCACGTCCGCAACGTCCACCAGTAACTCCGCGATTCGACCCGCGGTGCCGCAGTTGGGGCTCTGCAGGGCGCGCGGCAATTGCCGCCGCCTTGGCC
GCGTGCTCCCAAGTCATAAATTCACGCAGGAGCTTCGTCACCCACGTGCAGATTGGCACCACCTCGTTTTTATATTTCTTGTTTTCGTGCAACGTCAGCT
TCGTAGCGATGACGGTCTTGAAGCTCGGAGGTGCAAGCGCATCGGCCAGGTACCTGACGATTTTCCGCTGTTCGTGCTCAAATGCAACCTCCGTCAAGTT
GAACCGGTCCAGAATGGTTTCGAGGTCGGCCTGCAGATACATCATCCAGCTCTCGGGCTCTGACCATttcgtctgcatttgaagcttcttcatagcttca
tcaaccgaagcatagtcgacgtgcgagggcgcattcgcttgcttgaagtagtctaTCCATTGCTCCTCACTGATCAGGTGAGGAGCGATGCCAAACTCAT
AGCGTGCTACCATCCGCTTAGTCCTTGACTCCACGCAGGCACCGACGGGCACGGCAAAAGCACCACCCCATTGAGTCTGGAGCGCATTGATCACCGCCAG
ATAGGTCTCGTACTGACGCATGACATATCTCCTGTCCTGCATCGTTCGCCCGGCGAATCTTATGGGTAGCGGGAACGCGGGCGCGGCAGCCACGCGTCCT
CCACCAAGCACAGGACTCGCTGATGCCAAGGGCTCGTCAGCCTCGCTGCCATCGTTCGCCTCGTAGGGATTGGGATGTGAAGTCTCGGCCGGGGGAACTG
GGTGTTGGAGGCGCAGCACTCTCCAGCTGCATCGCCGCCGTACGTGCCGCCAGCTCGTCCACCTCCGCGCCTTCTTGCGTGGTCTCCGTCGGCCTTGGAG
CAGCGCCCTCAACGCCTGCTTCTTGATGTTCCATTCGGTCACGCGCTTGGTCATGCGCGGAGCTTGAGATTTGCGATGGAACTAAAGTATACGTTGATCT
CGCCGCGGCCCTCTACCAGGCTGCGCGCTCTCTACCGAGCTAAAGTCAAATTGTTTCGTTATTCGCTCGTGGACCTTTGACCTGCGACCTTTAacctgct
acctgcgtcctggacctcctacacttcctgttgatctctaggacttcacattcttcttctacctgctgtcgtgatttcatgatgtcgtcctccgcgttgt
cctccgcgttgtcctctgctggtaagttcgaaggagctggcttgatagaaaccgagccgatcactgacgcatcttgcacgcctgctggacacagcggtta
cttctatgagttttgtcttggatctcatcatcttacaacggtgtttcgatagtatctttcacttcctactggtggaaaggtcatgtgattgcaacttgct
attcgcaagaagcaatgtggactaattcacgccacggcaccggtgctacatgctggaccaccgtaagctagaggttatgataaaaaagcgtgcgtttgta
atatatatagtttaagtagcaaggggaagttcgtcatggtgtccgctagtgggacgaccatgacatctgtcatgctcgttgcgttctagttgctggggta
aatgatttcggcagcttcaactacttccattatgtaaacaccgacgatatacctatacatctccaaattcctctggcctatgacgccgtatttggctgtc
tgcacctggctaaggccttcagcgtgcgaatcagcgcgcaggcacggcgtgcccttggaccccaagtgcttcagctccaaaagtcgcaaaccactcgatt
aagtgcgatcacaagattgtcacacaacttcttgCTACATATAaattaatggtttgtcggggataaacagccagccaatcagaactgtttgatttattac
agtatgagacacagacaTGGCTTAACTGTACGTATTcagatatcgctctcacttccggtagcgggtaccaccatagactttaaaaggaatattttgtatt
aagtttgaaaggagcggagatgggctaaaagtggatttgcgacgcacaaaacactacctcgtcaacagctacatcaccaccataactggagccttcgaag
tcaacagcttccccattcatgccgttgaaggaaatgtcggtgtgcttgaagcagttctcgaccgtgcgttgtgtctgcatctcgttccagatttctcggc
tccattccatagtcttcaactggttcaccgcgtacgCGTAGACCCCCTTCCCCAGTGACTTCTTGTCCAACGGCTTCTTCTCCACGTCCTTCACCAACTC
GTACACCGAGTGTATCTGCTTGCGTCTGTACGCCCTCTTGAACGCCATTATGATGCCAGCGTtgtagtgggcctactttggctcactactttagcttaca
cgtcgcgtcacgtgtatgaggaggcgtaggagtttatttataatttgaattaattatacttgagtccacaagtataatataaaccaaataaaacaccaag
tagctagtttaaggtcaaatgagaactgtattgtttgtaaattgatcttcctcctaaatctgctaaaactgtttatcatctatgaaaggggttgacagcg
actggctgtcagagccccgccaatatgcacgtctctaataggtagaaatatgctgctttctaccaataggatctttgggtaggtgtggaccacgcattgt
ggtggcccacttcaatgtatccattggtgtgatttacatcaaggtgaggaagtatctaaaacctttaacagatatttatctgggaaactataagtgacaa
ttgtcatgcacaagtgacagttgtcatgcacaagtgactgttgtcacttgtgtgtgtaaccccgttacaccatccccccgttaagcttagacgtgtcggt
ctcgacacgtcaattaatattgactgcttgtcaattgtttgtgctggggatttccgtgctcatccgcaatgagcacgatcaagctgaagaccaccattgc
aacagagtgtaaactctctgttgttgagtaccatgcgcggtagcgcgaggtgcgccgctaccacggggacagacaacgcagtgtctgtgtacaattcttc
gatgtcgaccgcgtctgtgcgtcgacatctctaagcgaatttatgttgcttaccgtgatcgggtaagcaagtgtcaaagcacttcgagtccttctcgaag
cgaggcaagtattagcaactccacgctgttgcggtggaggctggtgtccgtgcgccgtgcgcactgtccgtccaggtggcggtgcgaattagcaaccgcg
accacaacaggtatactatatgtatacctgaaagcttcaatggtctccgtgctaattatctagcacgcgagtcgtcaggcattgtagattgctacagcgc
tcgcactaccttcttgctggtagagcgtgttgggcttcgtattccatcaccatgttcggaacgtcttccatcgggacgttccgtggttcccatgtgtcgt
gttggggagggaacctctccagcgaatgcgaaaacaatccggacctcggattgtNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNcggaagctccgcaggaatctcttccgggagtacgtc
tttgtactccctcaacaattcgtaatagggactcgacttcagcgagtcccagccttgttcctcgaagcgctctcgcttcgtcttcgcactgagagtgtct
tcactctcagtggtacttcctatgaagaactgcctctgctcttcgctctccctctccgttctttcgctgtccgaaagaacgcagacttgctcgatgcgtc
catcgtgcaagtcacgcgtgaggcgcttccagctcatgcctggaagcgaagtcaactccgacgacgtttcgtcCAGGTTATAGATATCTTCAGGAGGGTA
CAGATCCGTGATGTCTTGTAACCGCTGCCGCCCGATTTGAACTACCTCTGGATCCACCGATGCAGTCTCCTCAAATCGGTGCCACAGACGTAGCCCATGC
CGGCGCTCAAAAGCAGTAAGCCAGCCGTCCGGGAGAGAGAGGTCCCATGCGTCACACAGCTCTACCTGCAGGTCGCGAGCTTTCATCCTGATGAATTCGC
GCGACACGCACAGATCGAGTTGCTCCACCTCCTGAATCCACGCCCACAGACGCTTCTCCAACCGCAGCGATATTACGCGCAAaggcttgcgccgcgttcc
atccccgtaggcctcactcatgatggcgggcgcgttcttgaggatgtcagagatcgtcgtctgtgccggagtgtgtcggagattgagcgtcacagtggcc
cagacagctagctcgaactgtgtcatctttggactctcggcagccttctggatgatggctcgcttgGCATCGAGCTTCATCCAGGCTCCCATGGTTTGCT
CGTAGCGCCGAATATCCTCAAATGAAAGCCTGTTTCGCGCCCAAATTCAATCTGGACCTCCTGGACCATCTGGGACCCTCCCCCTTAAAATAATAATATA
AATCTGGTCGAGGTTATTAGATAATAGCAATACTGGAAGTGAGAGCGATATCTGTAGAACGTTTCGGTTCCGACATTGATGTTTGTTCCTCGTCATTCTG
TCTGCTTAGCGCGTATTCGCTCAGCTCTAGAGAGAATTTGCTGAGAGCGGTAGCGGTTTGTTTCTTCGCATATATCGACCCGCAACAATTTCGGGGCAAA
GTAGAAGAATGGCTCGATAGTTGAATGACTTAGGTCCCGGAGTTCAACATCAGGCCGGGCTTTGTCAGCGATGAGCCCATGGTATGGGTCCAAAAATTCG
AAGTCTGATGAAAGCATATTTCGAAGCGTTTCTTGTCGACTTTTTAGGAATTCTTTGCTAAATTGTTTGTCAACCTCAATACACAGTGACGCTAGGAACG
CTTCATCCATTTGAGCTGCATCAGTGTTTGATATGACATCGCCGTCGCCATCCAAATTCCGGCGCTCCACAAGTTCCTCTTCGTTGTCTTCTAGCGCGCC
GCCGTCGCTCTCCCCCGAGTTCAGCTGCTCGTAGCCACTCGGATTGTCATTGTCCTCTACAAAGTTTACATCTGGCTTGAATTCACGTCGCGGATGAAGG
CGTTTGGCAACGGGAACATCAGAATCTGACCTTTCGACGTCCGAAGGCTCTGATAGCCGTTACAACTGAGCGGCACCTTCGATTACATCTTGCTGTGACG
CGGCGTCTTGCAGGCCGCTTTGCGGTAGGTCAAATGCTCGAGATACTGCTCCTTGGGATAACTCCACTTCACTAGGGGTCGGAGAGGCAAAAATCACTTC
CAATGTGGTCTGCGACAACCACACACTGGTGTCGATCTGCGACGGGCGCACATTACTCTCCGCATCACCGCCGTCTTCAACGCATTGCACGTGAAGGCGA
CCCTCGCCTTGGTCCTCAGTTGTGTGTTCCTCTTGGTCTTCGATCGCATCACCTTTGTAGAATCATCAGCTCTAGTTACTGCGTCATGACCCGCAACGCA
AACGACATCACTTGCCTCGTTGTCGGCTTTCGGCAAGCCTGAATCGATGCAATAAGCCACCACTGCTGCCTCTCCGACAAATACGGCGATACCGACAGTG
GCGTTAGCTGAAGCGTCTGGCTTCAAATACGTCCAGTCGTTCTCGAGACCCTTTGGGCGCCTGGATTTCCAGTCTGCCACTCGTAGCTGGCGCCACAGGT
GCCTGAAGTCAACTTCCTGTGATGTAAGAGAGCAAGGCTTCTCACGTTCAATCAATCGAATGCACGTCATTGTGAAGGTTCGCGAATGAGGGATCTTCAG
AGGTGCGCAACGGACGTCATGCCTTTACGTAACCTAACCTCGTCCCGTTTCTGTAATTCCCTTATGACCTCCACCAACTTATACTTTGCGGAAGGGAAAT
ATCacttgattaaattattgcgttctggcttccgagccatttcctcttgttcgaagctttttcgtcgtagcttacgacttacgatttcttaaagtcgtaa
gttacgacgttgagaaccaaggagttaaGGGGCTGTTTCAGTTGAGAATAAGTCTGGAATAACGCTGAATAGAATAGCTATTCAAACAAAGCAGGTTTGG
AATAACTCCCTGTCGACGGGAAAAATAATATCTGTTTGTAAAGGTAGCCGAATCCCTGGCTGTTCATTTATCAATGCATACAGCCGACGAAGTCGGCGGT
GGCGGCGGTACGACGCCAGCTACGGACAGCGCCTAAGGGCTTCCAGCCCCGCCCCCACCCAACGCCTGCCATTTACAGCCTGATCCCGTCGTCCGGCGCG
CTTGATCCCGCTTGGTAATACGAATCATGCTAGCCTGTATACGCGTGCATCATGCGACTAAACTCTTGAGATACGAACTTATTTGCGCTGAAGTATAGAG
TGCCACAATTCCCGGGCCACGTGGCTTATACAGGTCTCTACTACAAGACGTTACTGGTCGAGAGCCAACCTTCCACTCGCACAGAGCATCCAGCTTCTGC
GCAGCGATCTGCGGCCGTCCACCAGGATCTGTAAGTTAACGATTGCGATGTTGCTGCTTTACGACCTAAGACTGAACTTTGCTCTTTATGGCTATTGTAA
TTCCACGTAGGTGCGGCAATGGCAGAGATGAAAGATCCACGCTCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCcggg
ccgacctaatctcttggcgctgccagtcgagtaccctacaagcaatgactctcaggtaccgacggtaggcataatcctaccccggacagcgacttaccgg
taagtgtgcacgtgttgtgggcgtagaaaattctgctctgtttgttcttaagtctttctgggtactctgaaaaggcgtctccactattcccaaggtcctg
tacaaatactaagtgaagtggagtggtttcggatctcagccgacccatcaccctcgctacgacgcttcgaactcggctgattcgATTTGCCGCATCGTCA
CCATTGTGTAGGAGTACCTCATACAGCATGCAGTTGGCTTCCTTTTCCGTCACAAGTGCAACAAGCGCGACCAACTCCTGCAGCAAGTTTCACTCAGAAA
TAAAAACAAAAGTGTGCAACACGAAACAACATGCAATCACTCTTCCGTGTTCTACGCCGCAAGTCATGTCGAGTTCTCGTCTTAGTATTTGAAATCGCCC
TTTCAGCGCCCCAAATACCATCTCGACGGGCATGCGTGTTCTTGGGTGTGCCATATTAAACTTGTTGATTACTGGATTAGCTCGTTGCATGTGGCCAAAG
GGTACCAGCATATAGGACCGCAAGGAATATCCAACATCGGCAACAGAGTGCATACCAGACGGTACTCGTTACTTGACGCACTTATCCATTACGCTTATTT
TCGGTCATTGCAACTTCATGGGCGCACCGAGAACGCCATACAGCGCCGGTGGGCGTCGGTGATCGCCATGGCATTGTAGGCGGGAAACCCTTTTCTACCG
TACCACCACCAAAATGTTACCGGGTGAGATCGCTTGGTAAGCGTTCGACCAATGGCTCCTGCCACGTTTGACATATCATGTACACCTTCAAAACTTGAAG
CTACCTCGGAGCACTCAGATGCATTCCTGGGATAAAATATAAAACGCTCGCGCTCACAGTACAAAAAAGGTATGATTCGCGCTAACACTCGAGAGCCTGT
ACATTTGGTAACACCAAAAGTTTGAAACACTTCTTTTAGACTCCCGCGCGATCCAAGGTAGGAGAGAACAAGGACTACCGGTTCCCTTAGAAAACCTATC
GGTTTCTTTCTTTAGAGTTCGCGTTTCCCTTGCGATATCTAGACCATTTAGATTCGATGAATATCACGGTGTCCTCGAAGCAATCACGAAGGCGCTTCGA
AAGCTGGCATCATCTTGCCGCAGACCATCGTTTTTCGTAAAGAAATCTGTTCGTACCGGATGTTGTCAGCGTCCATGCTTCTACCATCTGCTTCAAGATG
TAGCGCGAACGCGCAAACTATAACGCAGACGACTGCAACCGCGAGTTCGCTCTCTATCGCTCGGTGCAAACTGACAAGCTGTCGTGTGGCCAATCGACCT
ATTTCCAGGATTAATTTTATACTGACTTTAAAGCCAGAATAGATTATTCCTTG