Description :
From Genome Similarity Track
Location :
contig_60:266226- 267611
Transcript NameFunction/comments
g9102.t1hypothetical protein

Sequence
1385 bases(100 bases per row)
TTTGGCGCAATTCGTGCCCTGCAACTTGTTCCGTGCTTGTTGAGCATCCAGCCCGATATTCTGAAGAGCAAGGCTCTCCTTCTTACCGCCAAAAACTATC
TATTGCGAAACGAAGAGTCATTGGAGTGTGAGCTGCGGGCCTTGACGGCACCAAGTACCAGAGATAGTGCTAAGACTGATGGCGTATCAGTTGTTGGCTC
TGTGGCCATCCCGCTCCCAGACGCTGAGGTGAAGACTCTATCGCCAATTATCAGAACTGCGTTGAAGGTGCCTGCACACGCCTTGGCGGCGGGACCTCAG
TCGAGAGAAGAGGTCAACTCCACGGCTACAGTCTGCACCTCTATGCCTGACCATGTCGATACTGTCGATAGTGCTGCCGGCAAGAACGATTCTGCAGTGT
TGCCAATTTCGGCTTCTAAAGACATAGTTTCGGCTACCATTTTGGCGCTGAAAAAACCGGAGTTCACTAGCCCACCAGGAGGAGTATCACCAGCGACCAC
TATCCAGTTGGCTGAACCCATGCCAGAACCTCAAGAGGCAGCACTAATTGGGCCACCGCCCCATGTGACCAATATTGTGGTGAATGCTCCCACGCCGGCG
ACGACTACAGCGGTGCGCGGGATTGATGCCAATCCAGTTATCAAGAAGACTCCGAGTCGGATACTCCAAGCGACAGTGGGGATGAATTTCGTGCCGAAAA
TCTCTTCGGCGAGCCTATCAATCCTACTTCTCCGCAGCAACAGCAGGAAGTAGCTGCCATCTCCCCGGTGTCGTCGACGCACAGTTTCGACGAAGCGGAG
AGCTTGTTCGGTGAGCGTCTGTCCTGCTCGTCTCGCTCCAGCACGAGCCGGCGAAAGACTGTAACATGGGGCGAGGCCAAAACAATGGAGGTCCCCGTAC
AGCGAGCCTCATGCATCAACAAGAAGCCGCCCCGCTTATTTTCGGCCTTGCCACCGCAGGCGCCTTCGACTCGGACTCGGACGACTCAGACGTGGCCTGA
AAATGAAACATACTCAAGTGTAAAGCATTGTGTCGTTTTGCCTTGTCGAGGCAACGCAGCTTGCACCGACATGACAGAACGTAGTTTCACATATTCTAGC
ACACAGGTTGAGGTTCACAATCCCTCGACAAGCAAGATGTCTTCGCCTCAAATGCAGCCGCGGCAGCGGCCTAGCAGCGCCGCGAGCCTCCACGGCGACT
TCCGGTGGAAGTGCTGGGCAGCCAGGAGTCTCTGGACCTGGACTGCGGCAAATTTTACACGGCAAGTAGTGTGTGTTGGCCGCTGTAGCCACGGTCTCCC
CAGTCTCACCTTGTACGGCTGCAGGAATACATCCTGCGCTGCTCGTGGATCGAGCGCAATGGGACGCCAGAGGTTCGTTGAGCAG