Description :
From Genome Similarity Track
Location :
Scaffold_1515:2662- 4437
Transcript NameFunction/comments

Sequence
1775 bases(100 bases per row)
ACTTCCTTTGCCTTGCCCTCCAGGCAGCGGCTCTCGCACGTATCAGCTTCAAGAACGGCAGTGACTTGCTCTCGCAGACCAAGGTCCATCAAATAGATGC
TAATCTCCTCCGTAACATTAGCATCAGCATCGTTGCCTCCACTCTCAGCGCTCTCAGCAGTCAGGGGATCTTCGTCGTCACTGGATGGCTGTGAGTCAAG
AGTAAAGTCCTCGTCCCCGCTGTCGTCAAGCTCATCGCTGTCAATACTGCTGTCACCGTCCTCCAAACCCTCGCCATTGCTTTCATCGCTGCCAGCAGCA
CCGGCACGAACGACAGGAGCAGGGTCCTGCATGGTAGGGCGTCGTTATGGGCAGCAGCGGCGTACGCAGCGAGATCTTCCATGGCACCGTTGAGACTGAT
ACACCTCGCCCAAATTTTTGAAAAGTGAAAAGGGGCTCTAACTCAGCAATTCAGTTATGTCCGAAAAACGGCTGGTCAACTTCAGGCCCGTTTTTTTCGA
AAACACCAAATGGTTGATTAGTAACATTTTGTATCCCGTTGTCTCACATTGACATTCCACAAGACAATGTCTGATGGCTAGGAAGTTCGATAATCGCCCA
ATATATGACATTTATTGACAATCACGTATGCTACGTTTGTTTCCTTCGTATTCACAGTGTCCGTATCAATTTACTCCCACTTCTTCTTTTTGCCTAGTAC
AGTAGTACATCGCGGCATTAAGGACAGTCAGCGGGTTTTCACGAAAAGCCACGTTGGCGTGACGCTGCATTCATCTCTTCAACAACGAAAATCCGACTTC
AATCGGATTTATATCCGGCGAGTATGGGGGCAAAAAACAATAGCGCGCCAGTACTGTAGCGGGGCTACACAGTCGGGTCACCTCCTACATTAGTGCAATA
CGCAATAATGGATGCATTCAGGTTGACCACTCCACAGCGTGGTCTACATTCATTTCAAAAAAATATTACTAGTAGAAAGCAACATATTTCTACCAATAAG
AGTCATTAGATAGGGATTCTGCCAGCCATCCGATGGCGTAATCCCTCATTAGAAATATCAGTTTTACGAGGAAATCCAGTTAACAATCAATTCACTTCTC
ATTTTACACCAAAGCTATCGTTTAGTCCCTTTATTTAGATTTAATTATACTTATGGATACAAGTATAATGCATCTAAGTTTAATACTTCCACGCTTCCTC
ATACACGTGCGCACACATGTAAGCTAAAGTATTGGGTCTAAGCAGACCCAATACAGAGGGACAAACCCGGTCAAACGTTATATCCAAAAAGGAGATAGAA
CGACCGAGGCGCGATGATAAACGTCGCGCCAGCTCGCGTCTCCGACGAGAGCAAACACATAAATCTAGTGTTTTAATGGTCAGACTAACAACGCTTCGGG
ATAATTGAATACATGTAAGGTAAGCCTACGTCAAAAATATGCTTTTTGTCTGCGCTATCTCAGGCCCTGCAGAGCCCTAGTTACAGTAAATGGCAGATTC
CAGACGTCACTCCGAATGATAATTCAACGACTTGGAAAAACTATTATCAATTAAATGAATTGCATACAAATCGGTGGCTATATGTGCAGGTATCTGTAGC
AGCGCTTGCTAAAGTACTTGGACAATGCTGATTGCTGCTTTTTGCATTCCCTCGCTTGTTCTGCTCTTTCTTTCCTTTTACCGTTTTCCTTATGCAGCTC
GTGTACCAGTTGATTACACAGCCAGCGAGTCTCGATACTGTAACGGGAGCAGGAGCGGTAACAGCAAGTGCGACG