Description :
From Genome Similarity Track
Location :
Scaffold_1637:266- 4139
Sequence
3873 bases(100 bases per row)
GGAGCACGAGACGTGGAAATGGAGTCAGTGGAGGGAGACAACTTCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTAA
TAGCAACAGCCACAGCCGGGGCAGGTGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGACCTGAAGGAGTTCACGGGCAAGGATCAAGAT
GAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAG
CGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCGGATTTGCTGCGCAGCTTCCAGACCCAGTACTGTGTATTGGG
AGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTGGAATACCTACATCGACTAAATGTGGCCGGTCTACGGCCCAAG
TTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACATGTGGATCATTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGT
TACGTCTTCTCAGACGCAGATGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACTCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTAT
CGCTAAAAGGCTCCGACGCTCACGGCTCCAGCTCGACGTGTCTATCAAGTCACGGCGCCTGACTCAGGAACTGAGTCAGGGATCCGACGGTTCGGACTCC
GACCCAGAGGATTACCGTTTAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACTGGAGACAACTCTCGACCGAGGGATACCGTACCCGGGGACC
GTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGCCCAGGTCAGGTGTGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTAGTCTG
TGAGAAGTGTGGCAAGAAAGGTCATCCCGGAGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGTCCGATGGAAAAA
TTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTT
GAATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCCAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAAT
ACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGATGAGTTTTCCAGATCCGAAGTCTCTTCAACCCTGGATCTACACA
GAGGAGCGGCACGTGGTTATTGGGAGAAGCGCCAACATGGTCGATGGTTTGAGCCAACCAAGGGTAAAGTCACTGCAGATCCACCTAAGGTCTGTCTGGT
CACTGGATCCTATGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGAGAGTCCCGTGGGTACTGGAAGTACCATGCCCCGGGAAAGTGGTTCAGA
CAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGG
TTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATCAAGATCACGCTGGC
AGGTTGTTTGGTGTATTGGTTCGACATTTGGGTCGGGGATCTCGCCGGTCAAGACGCCATCCTTGGGATGGATTTCATGGTGCCGGCCGGAGTGAGGTTG
GATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGG
ATAAGACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGCCAGACCGGTTAAAGTGGGTGGAACATGAAAGACTGTGGGTCACCCGGGGCGAGAAATG
GGTACCTACCGTAATCCAAGGACCAGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGACAAGATATTATTACTGGACCATTATGAGGAGATCGGG
CGATGGTTGGCGAAGGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTA
CCGAGATCGAATCTCTCGCAGAGGTGGAGCTCCCAGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATACCCAACTCCGCGAAAGATCCTGCAGAG
GGATCGACGGGTTGAGATCCAAGCAATGAGAGTTGGATCCAGGACAGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGA
TTGCAGAGGGCTAAAGCCGAGCAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTCTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAA
CACTAGTCAAACCCGAACTGTCGGTCTTAAACTCGTTAGAGGACCAACTGGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGAACCCCCGAAGAT
AGAAGGACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATTCAATGGTGGATCCTACCAAGACGGAAGATGAGCTAGTCTGTTACCGTGAAGGCGGGGAT
CTACACGCCGAGGACCTGGGAGAAGGCCTGGCGGTGATCCCGGAGGTACCACTGACCACAGAAGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGG
CGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGG
AGTCAAATGTGACATCGATGTCGGTGACGCGAAACCGATCGCTCAGAGGGTGAGGAAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAA
GGCCTGCTGCAAGCCAAGATCATCAGTTTCTCTACGTCTCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCA
TAGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCACTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTG
CTCTCTTGACATGGCCAGTGGTTTCTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAAC
CGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAGCGCTCTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTG
GATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGCTAGGACGCAGATCTTACATCGACGA
CATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTTTCTATCAGTGTGGTAAAG
AGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCTTAGGACCTATCTTCGTTAGCCGATTTGCC
CTTCCCGCAGTCGTTACGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATT