Description :
From Genome Similarity Track
Location :
Scaffold_1883:266- 1835
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1883-snap-gene-0.1Amino Acid/Auxin Permease (AAAP) Family

Sequence
1569 bases(100 bases per row)
AACCGCGTCTTCTTCTCGTTTCTTTTCCCCGCTTGGCGGCTCCGGCGTAACTCCACAGCTCCTCTCAGTCCGTTCGGAGTTGCTCACAGCCCAAAAGAGT
CTCTCAGCAGCGACCATGGCAGGCAAGGCGTGGCTCACGCTCGAGGACGCCAAGATCGCGTTCAACCTCTTCTGCTGCATCTACGGCATTGGCACACTCG
GCATGCCAGCCAACTTCTCGCGCGCCGGGCCAGTGCTCGCGGTCATCGCGCTGCTCTTCATGGCGTTCGTCAACGTCTACGCCTCAGTCGTCTGCTCCAA
GATCATGCTGCTCGCGCCGCGCTCAGTCAAGACCTTCGGCGACCTGGGGGAGTGGTGCATGGGCACGCCCGGCCGCTACCTCGTGCTCGTGTCCCAGATG
GGCGTCTGCCTGCTCCTGCCGTGCGCGTTCTTCGTGCTCGGCGGCACGTTGCTCGACAGTCTCTTTCCGAGTGCGTTTGACCAGCGAACGTGGATCATAC
TGATGGCCATTTCCGTTCTTCCCGTGAGCCTGACGCCGACCATGAAGGAAAGCGCCGGCGCCGCGTTCGCTGGCTGCCTGGGAACTATTGTTGCCGATGT
GATCGGCGTCGGCGTCCTGCTGCACGGCATGAGCGGCCACCCGTCAATCCCGACTCCAGCTATCACATTCAAGCAGGCCGCTACCACTTTTGGCAACTTC
TCGCTCGCGTACGGCGCCGGCATCATCATCCCAGCGCTCCAGCGCCAGCACAGCGACCCGACGCGCATGCCGCGCATCGTGGGCGTGACACTGACTGTGA
TCTCGTGCCTGTTCCTGATCTTGGGCGCCACTGGTTACTCGGCCGTCGGCTGCCAGATCTCCGGCAACCTGCTCTTCACGATCAATCCGGACCCCACCAC
AGGCCTCACGCGCCTCGGCTTCGCATCGGACAAGGGCATGGTCGTGCTCGCGTNNNNNNNNNNTTGCATGCAACTGCACATCACAGTCGCGCTCGGAGTG
CTGCTCCACCCGGCGTTCTACATCCTGGAGCGTCTCGTGCTGGGTATGCACAAGAAGAAGCCAGAAGACCTCGAAGCCAACAGCTACAATGCCATTGACA
CCCCCGATGGCATCAAGGACGAGCGCACGTCCAAGGGCTCGGTCGTGTCCATAGCCGATTTCGAGAAGGAGAATCTGGACGCCGAGGAGGAGGCGCGCGA
GTACCGTAGCGCCGGTGTCATGATCAAGTACGTCGTCCTGCGTCTGACATGCGTCACCGCGCTCGTGGTACTCTCCATCGCACTGAAGGACCACTTCCTG
GACTTAACAGATTTTATTGGCGCGTCGGCCATGACGTTCAGCTGCATCATTTTGCCGATCGTGTTCTACTTCAAGAAGCTCTGGAACAAGATCCCGATGT
ACGAGAAGGTGGTCGGCATCCTCGTGATCTTCGTCTGCTTCGTACTCGGTTGCTACGTGACGTACAACACTGGCAAGGTGCTCTTCAACCCAGACACTCC
GGACCCGAATGCGCCGGCGTTCCCGTTCTGCCACCCGAAGGATCAGTTCGAGATCTACTACATCAAGAC