Description :
From Genome Similarity Track
Location :
Scaffold_1529:266- 1745
Transcript NameFunction/comments
Phyag_g10879conserved hypothetical protein

Sequence
1479 bases(100 bases per row)
CCACTTCGATGCCTTCTGCACGATCACTAACGACTGCGCGTCGGAGCCAGCAACGAGCGTGTCGGACTCGGCATGAACTGCCAGAGCGTTCCACGGCTGG
GATCCCGAAGCAATCGGCTGCACGTGGAGGGACCCTGGTCCGTTAGAAGCGCCAAGCGAGCCGACTGGGGTCAAGTTCTGGCTAGCTGTAGATCCAGAAG
CACCGCCGTAACGTTCATACTCGACAGGGTCACGAGGGCTTCGACCGTGATGGAAGTCCCAGCAGTTGACCACGGCATCATCGCCACCCGTGTAAAGATA
ACGTGGCGACGCAGCGTGGAGCTTCAGcgctcgaacagctcgttgGTGGAATGCCTCCGTACGGAACGGCGCATCAAGTTTGCGTTGGTCCCAGAAGTTC
ACGCGACCGTCATCAGCGCCGGTGATCAACAGTTCTGGCCGCGTCGGATGTgtctccagcgtcgtcaaAATGCTCCTCGAGCTAGAGCTGTCGAGCAACA
TCAACACTTGTTAGTGCACATCATTTCACGCTTCGAATACTGCAATCTACCGTACTCGGAACATGTCGTGACCGGAAACTGGTTGTTCGCTGAGAGATCC
CATATACGAAGCTGGCTTCCAGGGGTCGACCCGACCGTGGCAACAACCGAGTCGCGACCCAAAAACTTGACCGCATTGATCGGTAGTTTGCTCGTGTCTT
TGTTCTCTTCTCAGCATCAAAACACTAACCATGAGTTCACACACAAACAATCACCAAAGGTTTGTTATCCACTCACCAATTTTCTCCACACTCGTAGCAT
CGTCCAGTTTCAACCACGCCAGAGCTCCTCCTGCACTGGCAGTCACCAGACTCGTGTGGTTCTCGCTCACCTCCACACATGTCGCTGCAGACCCACCAAA
TACTTGTTCCCACTGCGGAATAGCGAAAGCAGACAGTGGTTTGGCTGAATCTGCGCCCGCCATCGCCGCGTCGTCCtctccagcacttgaagaTACGCGA
AAGGCGAGGACACCGCCcgccgacgacgcgctgACCAGGAGATTCTCTCCTCTGGCCGccacaaactgcagcgcgttcacGTCGCCGTCATGTTCCGCTT
CGGCCAAAGTACTGAGCTCACACGGACGCGCTTCATTCTCTCCATGGCTGCATATGAGCACAGGGAGCTAGCTGGTTAGCATAGTATAGTGATGCCTAGA
TATTCTATTGCGGGGCTGTAGACGCACCCGAACTCCCTGCGCAGCTCCCGTTCGTCGCGTGTAGGACGCACTGGCAGATGCAGCGAGACGTGGTTGGTCT
CGTTGTCCCAGCCGCCGGTCGCCACGAGGGGAAGCACCTCGTACtcgttctgcagcgtctcggaCGCATAGCGCACGTCGCTCACGACGCACAGAGCATT
GACCTTCTCGGCCACGAAGTGCCTCGACACGACGGCGCTCATGTCTATTGCCAGATTTGAGATTTAGACAGTACTAAAA