Description :
From Genome Similarity Track
Location :
Scaffold_3815:266- 1356
Transcript NameFunction/comments
Phyta_totarag15492hypothetical protein

Sequence
1090 bases(100 bases per row)
AATGGACGTCATCTTCGGTCTTCCGCCTGACGCCAAGTGGAGGACTGGTGCAGGGGTCCTTGTAGGCCGTTTCAGCAGGATGGTGCATCTTGTTGCGGTA
CCGGCTGCGGTACCGGCCGTGCAAACAGCACACCTGTTCGTGGACTTGGTGTTCAAACACCACGGCATGCCGCGCGACATCGTGTTGGACCGTGATCCGC
GCTTTACAGCACGGTTCCAAGAAGTGAGAACATTTCTTGCCATAcagctgtcgatgtcgactGCGGACCATCCGCAGACGGACGGGCTGACCGAGCGCGT
GAATCGCGTGCTcggcgacgtgctcaagGGTTACGCGCACCTTTTCCATCACTGGAGCAACTGCTTGCCGATGGCGGAattcgccatcaacaactcgGGG
CATGCCTCGACAAGGCATACACCGTTCTACGTGAACGCCATGCGGCATCCACGCCTACCGAGCATGCTCGGGGCGGTGGCTTCCTCCTTAAGTGGGGAAG
GATCTACGGCTGCGGACAAGCAACCGCAGAAAACAACTGATACGACNAATTCAAGAAGGGTTCATTGGTTCTGTTAGCTACACAAAACCTAGCTAAACAT
GCAGTCTCTGACTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCGTTCACTGTGCTTGAACGGCACTGCAACGCCTACGCGTTGGACATACCAT
CCAGCATGCGCCTCCAACCGACATTCTGTGTCGGGCGGCTAAAGCCGTACGTCATCTAGTGTTGGTGACTcgccgaagcagaagaagaagaggcgaCCTT
ATATCGAGCGAAGCGACCTGCTTCGTCAACCTCGCGAGCTTCGTCCCATGCTCGATGATCAAGTTCGAGGCGGTCTGCGATACCGCCGCGACCTGAGCCT
TCTGAAagctcagctcctgcttcagaGAGGCGAACTCAGTACTCTGAAGTGTCTCCACAACCGACACTCGGTCATGGAGACGAGAATCACCCTGGTCAAC
CGAAGGTTGACCATACAAGAGCGTGCTCCCACCTTCCCCGCCGCCACTGCGTGACGCACGTGGCTCGACCCGCTGGATTGTGGAGCGGAT