Description :
From Genome Similarity Track
Location :
Scaffold_4:265953- 268267
Sequence
2314 bases(100 bases per row)
TCGCGGGGTCGACTGGTTCTGGAAGAGTTGATGAGAAAACGCGAATGTTGAGCCAATAGGAACACAGCAATTAGGTCATGACCTGATTTTGATATTTGCC
AGGTAACACGGGGTTAATGTGGTGATACCTACGAATACCATGTGTCTAGGTCATGACCTAGTCGTGACTTGGCCGCTGATACTTTGATATAGTACATCAT
AGCTCGTTAGTGCGTCACATCAAAGAGTTATTCCACTACGTACCAAATGCCTTATCGCATGCTGGTTCAGCCACATGATCATGTTTGCCTAGATTAAATC
GTATGTACAGTATGTCCCAACGCGGCGAAGTAGTCACGTAGGCTTTTGTACCTACCGGGACGAGTTTCTGTGTTCAACAAGTACGTGTGGGCACGTAAAA
CGTACTAAAGTTGCCTAGTTCGGTTCTTGTTTAATAAGTTCAGCATTTCGAGGGTCAGGGAACCTCTGGTAATAGCAGGTAACTCTAGCAACTAGCAGCG
GTGCGCAGTATCAGCCGACTAAATCGCAACAAACTCCAATTCAAAGACAAATCTAGCAACTAAGTCGACCGCTTGAGTTATTGTGCGTTTGGATTCAAGT
TAGCTCGAGCGGATTCAGGTTAACTCGAGTACTCGAGTTATTGTGAATCTTTTCCTGTGGATTCAACATAACTCGAGCGCTCGAGTTGTTGTGAATCTGG
TCAAGTTAATATGAATCCACTCGAGCTAAATTGAATCCCGATGCACTCGAAAGTGACTATCAAGCAGTTGGTTTAATCTGCGTTCTAAATGCAAGTTTAC
TTTGCAGAACAACTTACGCTGCATTGAATGCGTGTAGACAAGGGGTGTTGCTTGAGGCTGGGAGGACAAAGGTGGAGTAATGGGAGATAATGAATTATTG
TACTCATTCCTTCTGTTCCAGTAGCCGTTCTCGCCAAACTCATTAACCACTTGACTGTGTAGATGTTGGGTCGAGCAAATATAAAAAAAATCTGACGTTA
TGGAAATCCTTCATTTGCAATTCGCCCACGAGGTTTAGCCAAATGAAATTCAAGTTATCGTAAGTTTAAAAATCGTGAATCCTACTGGACTCGATGTAGT
TTGGCTACTACGAGACTCCCAACCAAGATCGATCAAGCCGACGTCGTTGCCATGAAGCCACGTGAACTCGAAAGTGTAGTCCGTGCCTATCGAAACACAA
CGTATATACCGTTAGTTAAGCAACCAAACCTAAACCAATGATGGTGCAGTACGCCGTACCGAAGTGCTGGAGGGAGATCTACTCACGCGTCATACGCGTG
AGTGAGGAAGTCGCGATGGAGCGGGCGCGAGCTTCTCAAACGTGAGGTCACTCTCGAAGTTATCGAAGGGACACAGATGAAGTGCACCTTTGCCAGCAAA
ACGCGCGGAATGTGAATATGGAGACGCTGCGCCCCACTTCCTATTTCCTACGTTACCGACAGCTTACTAGCATTATAGTTTCAACCACATCAGTTTCAGA
CGCATATTTCCTCTTTCAGCTTCTTCTTCTTCCAGCTTCAGGGACCTCCACCAGAGCAGCTTCACGAACAGCGCTTCTTCTTTGGACCGCCATTGGCATC
TGGCGCCTTCTGCGATTCGTTTCCCCCGTGGCCATGCGCCACGCAGCTCATAGTCGTCGGGGGCAGTTGTGAATACACGTACGGGCAGTCTGCAACTCCC
ATCCAGCAGGAATAGCAGGGTCAAGTACCACTTTAGTTGCCGAACTGATCCCAATGGCAACGTCGTCGTAAGTGTTGACTTTCAACGGCTAGAACGTGAA
GCTGTAGTAGGAAGTAGGAACGTCTGTAGTTGGAGCTGGCGTAGCATATTTGTAGCAAAGACAGCAAGCAAAAGATAAAGACAGCAATGCAGTCGCAGCA
TGCAATCTGTGTTGTCTGGTTTCTTAGAGTCTCCGGTCTCATTTACGTATGGATGGTGTGTCACAATGCTGATGTCGTCGGAATGTTTTCTGTGGTACGA
GCAACTTTTTTTGGACGAATTAATGTCTGTGAGGCTCTCCATGCAGCTCTTCTACACTCCACGACAAAAAGATATGGACACCACCAAAAGTGGCTGTAAC
TTCGTCAATTTTTATCGTTTTAAGGTGCGGTTTGGACTAGAGTTGCAGAACACGCTGATAAAGATCTGCACGTTGCTAACACGCGCGCTTTTGCGCTTCT
TCAGGTAGCTCACATACAAATCACTGGTTCTGCCCAGGTGACAAAACTTATGGACAGCTAATCCCCATACAAAATCCTATATTAACCAAAACCCCTTACA
AATGATACGACTTG