Description :
From Genome Similarity Track
Location :
Scaffold_559:26595- 28093
Sequence
1498 bases(100 bases per row)
TGTGGTCGCTCGCCACTCTATCGCGATTCACTCATATCCTGGTCGTGTTCTACATGAATGGTAGGAGTCGACCTACAAGCTCTGATTGATGGATTATGTG
GTTAAAGGGTTTTTTAGGCTTGCGCTTTCCTCCTCGTGCACGGCACGTGTTGAATGAATCCCTTTGAGTTCTACTCTGCAATCGACAAGCGTCTTTTTCG
TCTTCCTGTTTCCCATTGCCACACACTCGCAGCGCTAAAGCTGCTACTATGTTGGCAAACTAAAAGTACCGGATATACTTGTATCTTCATACTTGCCACC
CTTTTAAGCCCTTTCTCCCTCTTCTTACAGGCACCCCGTGTTAAATAACTGCGGACGGAAAACACGTACCGTAAACTTTATGTCCAAACGGACGATCACC
ATTTACGGATACCATGGTATGGCCAATCAGAATAGCGAGATGGGTGGCCGTATCTGTAATTTTTGTAAAATGAAAAGGGCGGCAGACGCCTCAAAAAGCG
CGCGCTCTGCAACAGTGGTCAAGGTCACCCCACCCGGGCGGCCTCGTCTGACCGATCAGGGGCGGACCCAGCCAACGCACAGATGCATATGCACGACTAA
CTGGTTGAAACTAGATATTGCTCTGTTTTTTTAGGAGTGCGGCAGCGTGGATATCGCGCTAGACAGATATTTCAGTTTGTTAGGCTTAAAGGCAAGAGAA
TCTAAGCGCAAGCTCATTTATGCGTGGAGAGCAAGGCGTGAAGCCTCACGAAGCTGTATGCCAAAGCTCGTTGCGCTGCGCGCACTCACCGCGAAGAaaa
cagcgccagcacagGGGCGCCCCGCTACTCGACTTTGTGGCGTTTTTGTGGTGTGTCACATCTAGCCACGAAATACCGTTGCCGTTCGGCTTAAGTACGC
AAGCACCGTTAATGTAATTTGCTATAACGGgccaggtgtgtccgttatTTAGCATACActatagactgcgaggaagcgcgtgagactcaggagactgagt
ctgagtatgggctttgggtcaaattgaactctgattTATGTNTCCCCACTTTCAACCAATGACagggctacgcgaagcacacgctagccGTGTGCTTTGT
ACCTATTTTGTATCTTTAGCTATATATatctacctacatatgtaacttcaaacagcccgttaCATTTTCAGTATTCCTGCATGCCGACCAAAAAAACATG
GCTGGCCCtagcgcccatgttttctatAAGGGATAGGTATACAAAACATGGGAATAGCCATGATTTGTCCATGATTTTTCAGAATAGTGACGGATATCTT
ACAGGACGGAAATTTATTATTTCCATGAATGTACCATGTTGGAACATGTCCAAAACCTGTTGACAGTACGAGACGAAAATTGAAGACTGATTGTAAAACA
GAAATGTCGGCCTTCTGTGAGGCATGTGTCAAGCCTActattgagggtaaccggtttgatagcggttcttaaccgtgaaccggttagcccgaaccggt