Description :
From Genome Similarity Track
Location :
Scaffold_1:2659286- 2664425
Transcript NameFunction/comments
Physo_474436P-type ATPase (P-ATPase) Superfamily
Physo_471735choline/Carnitine O-acyltransferase, putative
Physo_4763383'5'-cyclic nucleotide phosphodiesterase, putative

Sequence
5139 bases(100 bases per row)
CCGGCAGCGACTCGCCCGTCAGCGACGACTGGTCCACCTTGACCGCGTCGCCCTCCAGGAACTTGAGGTCGGCCGGGATCACGTCACCCAGACGCACACG
CAGCACATCGCCGGGCACGAGCAAATTCGCGGGCACAGTCTTCATTCCACCATCGCGCAACACTTTGGCCTCGGGAGTTAAATGGCCCATCAAGGCCGAC
ACAGCGTTTCCTGCTTGAATCTCTTCCAGGTACCCAATGCACGCGTTCAGCAGCAGCAGGAACAGGATCAGCGCGAAGTCGGCGTAGTCCAGCAGCACGA
TCGACAGGATGGCGGCCACCTCCATGGCCCACGACAGCGGGTTCCACATGAAACCCAGAAAGAGTCGCAGCTTGTTCACCTTCTCCTCCGGCAGCTTGTT
CGGTCCGTACACCAGCAACCGCTTCTCCGCTTCTTCCGACGTCAGGCCCTCGCGAGACGTGTTGAGTCTGTCAAGAGCGGCATTCAGTGGCACTCGGTCC
CATTGTACCTGGCCAAGCTCGTTCACGAAGTCCTCGGTCGGAGCCATTCTGTTGGTGGTGGTCAAAAGCTTTCTCCGGCCAATTGCAGAATGAATATGAT
CAAGCCCAAGGGCGTCATATTGCTCACGCCTCGTCCCATTGAGCCTCGAGGCTGGTCTCAAGTTCCTTCTCCCCTTCGCCCAACGCGGTCGCAAGACGCG
CTTGAATACCACCGTTGGGCTCACTCACTCGCTTTGACGGGTAAAAGGCGACAACCGACGCAATCTTCGTTTCCCCGATGCAGGGTCTCTCGTGAGGGGC
GTGCGAGTGCTTGCAGACGGCAGCACACTCGCACGGGTGGCCCGCCAAGAAGTCATCGTCGCTGAGGCCACGGTCCACCGCTTCGGAATTTGTTTCTCTC
ATGATAGTGACAGGGGATAGTGACGGGCTGCCAAACGGTCTTCAGCTCTGTGGCTCGCTCGGCCTCTGGAAGGGAAGATGGTCTCTCCAAGGCGAGGCTT
GCCAGGTGCAGACTGCAACTTGCAGTTGAACAGGTTGAATTCGTACGCAATGCGCTGACACGCAAAATGCCCCTCGTCAAAACCACGTCGCAATCCGACA
CAACGCAAGACCCCCAAACCAAGTTGAAGTTCGATATGTAGCCATCTGCTCATGTTAAAGAGCCGTTGAATGAATGATCTCTTCATTCTCGAACTCGCGC
TCCGACCCGCAACTAACGAGCGCCCAGGCCATCTATGGTGGCCAACGACTCGAGCGCCTCGGGCCACGACGCGGCCGCGTCGCCTGCCGCTGCCTGGCGC
CCGCCCACGGACGAGGAGTCCACCACGTACCGCCACCAGGCGTCGCTGCCCAAGCTTCCGATCCCGTCGCTGGAGGAGACGTGCCGCCGCTTCCTGGCGT
TCGTCAAGGCGCTACAGACGCCCGAGGAGCAGCAGCTCACGGAGCAGCACGTGAAGGAGTTCCTGGCCAGCGACGGCCCGCGGCTGCACGCGCAGCTGCT
GGAGTACGAGAAGGACAAGGTGTCCTTCATCGAGGACTTCTGGTACGAGGCCTACCTCAACCACCGCAGCTCCGTCGTGCTCAATGTCAACCCCTTTTTC
GTGCTGGAGGACGACCCCACGCCGTCGCGCAACAACCAGCTCTCGAGGGCCGCGTCGCTCGTGCTGGGCGCACTCAAGTTCGTCAACGCGCTGCGGAGAG
GCACGCTCGAGCCCGACATGTGGAGGGGCAACATGGCGCTGTGCATGCACCAGTACAAGCGGCTCTTCGGCTGCGCGCGCGTGCCCTCGGCGGGCGCCGA
CGACGTCATGGTGGACGAGCTATCCAAGCACATCGTAGTGGTCTGCCGCAACCAGTTCTACTGGTTCGACGTCATCTGGGAGGACGGCGTCACGGCCATC
ACGGAGCGAGAGCTGCTGGCCAACCTCAAGGCCATCCACGAGGACGCACTCAAGGCCGACGACGTCGAGGCCGCGTCCAACGCCGTCGGCGTGCTCACCA
CCGAGCGACGCGCCAAGTGGGCCAGCCTGCGCACCAAGCTGCAGTCGGCCAACAAGGACACACTGGCCGTCATCGACCGCGCGCTGTTCCTTGTGTGTCT
GGACACTACGTCTCCTCCGGACGCAGCGGCCTTTGCGGCTACGGCGCTACACGGCACTTACAGCATCACCAAGGACGGCGTGCAGACGGGCACGTGCATG
AACCGTTGGTACGACAAGCTCCAGCTCATCGTGTGCGAGAACGGCGTGGCCGGATGCAACTTTGAGCACGCCTTCGTGGACGGCCACACGGTTCTGCGCT
TCGTCTCGGACGTGTTCACGGACACCATCATCCGCTTCGCGCAGACAATCCGCGCCGGCAACTACGCGTTCTTGGAGGCCTCTTACCGCGCGCCGCAGCT
AAGTCCGGCCGACTCGCCCGATCGTCCCCGCGTGCAGCCGCACAAGCTCGAGTGGACGCTGGACCGCGAGCTTCAAGAGGGCATCAAGTTCGCTGAGGCG
CAGCTCACGGACCTGATGCTGCAGAATGAGGTCAAGGTGCTGGAGTTCACGGCGTTCGGCAAGCTGTTCATCACCCAGCACAACATGAGCCCGGACGCCT
TCGTGCAGATGGCCTTCGTGGCCGCCTACTACTTCCAGTACGGCAGCGCGCCGTGCATCTACGAGCCTGTGCTCACCAAGCGCTTCCAGCATGGCCGCAC
CGAGGCAGCACGCGCGATGACGTCGGACGCGCTGGAGTTCGTGGAGACGTTCTTCTCGGAGAAGACGCCGCTGGAGAAGATCACGTCGCTGCGCAAGGCC
ATCGCCACTCACGTGAGCAACGTACGCGACTGCGCTGCCGGCAAGGGCCCCGAGCGCCACTTGTACGCGCTCGAGTGCCTCTGGCAGCACGAGAAGGCGG
CCGACAGCAGCAAGCCCACGCCCGCGCTGTTCGCGGATGACGCCTGGCGCAAACTCAACCACTCGGTGCTGTCGACAAGTAACTGCGGCAACCCGAGTCT
GCGGCTGTTCGGCTTCGGCCCCGTGGTGCCGGACGGATTCGGTATCGGCTACATCATCAAGGACGAGGGCATCCAGTTCTGCGCGTCGTCGCGGCACCGC
CAAACCGAGCGGTATCTCAAGAACCTTGAGTCATACTTGCTGCGCGTGCAGGACCTGCTCATGCACGAGGAGGAGATCCGCTTCCCGCACTCCACCGCGG
CCAAGAAGAAGGCCGTGCAGGCTTCGTTCAAGGGCTACGGATTCTTCGACGACGGGGGGCAGCCCACTGAAGTCAAGGCGCTGGCATCGATCGGAGCCGT
CGGCAAGCCGCTCATGTAAGACGAAGCAGATTGAAGTACTGTAGTAGGTGGCAAGAAGTTCGTAGTGACAGCGTGTGGCGTAATTCAAGTGGATCCGTAT
CCGATATTCTCAATGCGCTGCGCTTCGATGATGGAGCTTCCTGGTGCCCAAGTCACACAGCTGGCAAGGAAGCGGTTTCGCTGCTATTTCGACTGCCAAA
CGCCACGCTGGACTCAACACGAGGGGCGGACCAAGTTGACGCGGAGGAGACAGAGAAAGCCGGCAGCGAGTTTCGATTTTCGTAATGCAGCAGCAGCCCC
CGACGACAGCCCGAAAAAGCCCCCAGCGGATAAGACCGAGCACCGTTGCCTTCCTTGCTGCTTGCGCTCTTAACATGGAATCGGAGCCCCCGCAGAAACG
AACGAGGCCGTCGCCTCAGCACCTGGTCGCTGCTGTAAATGGCATTGCGACTTGAAGTCTCCAACAATCAGTCAGTGAGTCTGATCAAGTCGGGGAGTGT
TGACAACGAGAAAGCCATCGCCTCCGTTTCGTCGGGCGAATCGAGTCCGAAACGCACACGCACGCGCGTGAGTGAGTGAGTGTTGCTCTCCGGTCGCTCT
CGGGCCCTCGGTGTTCAACCGCTGCGTAGACCTAACTGGGTGGGGCGCGACGATGGCCCGCTTGCATCGGCTTGAAGGCGACTCGCACTTGCATCCACAC
GTCGACGCCTCAACCCACACGGGCCCCTCCTCGCTGACTGTGAATCTCCCCTCAATCTCCACTCCGTCGCCGCTGGACGACGGCGACAAGAAGTTTATGC
CGATGCCGCCGCAACGCAGCAGCAAGCCCCACTCCAAGAAGAACACGCAGCTGAGTGATAGCCGCATCCACCTGGAGCCGCTTCGTCCGCCGACAGCAGG
AACGGTTGCCAGTGGGCGGGTAAGCAGCACGAGGCTCACGGTCAGTTCGTCGTCGGGCAGAGTCTCCTGGGACTCGACTGTGATGGAACCAGGCAGCACC
GTATCGGAAAACCTCAGCGCCTTCCAGGAGCTGGATCGCAAGCTGCAGTTCTACAAGACGCTCGCCGCCCTGAAGATGCGAGACGCGGCGCAGTCGGAGC
AGGCTTTACAGAAGACGCTCACCTCGTTACTCTTTGCAGCAGCCACGGCACTGGATGCTACCGTTGTGGTGCTTTATTCGCTGTCAACGGCCGAGGTTCC
GGTGGTGAAGGTTGTAGCCTGCTCCACCTCAACAGCTGTGAACTTTCAAACCTCGCTAGAGAACTTCGCCTTGCGAGGCCTTGTTGAGCATTTTAGCATC
CACGACGATGGAGCACCAACCACAGGACCCGCGGCCACGTACGTTGCGTGCCTGCAAAACTTGGGGACATACGATCTCGCGTGCGATGTGGACTCGGTGC
TGGGCTTTTCGACCGCCAGCGTGCTGGCTGGAGTACTGCCGGATGAGCACGGACGACCGCGTTTTGTGGTGGAGGCGAGGAGTACCCAAGAGGGGCTGTC
GTTCTCGAAGGAATTCATGCAAGCCACGCTCACAGCAGTCGAGAACGCTGTGTATCCGTTCGAATTGCGGCGGGCACTAGCGCGGCACACTCAATCTGAA
GCGGTGGTGGAAGAAGTTCTTTGGCACGCGGTGGGCCCACCCCCAGACACGTCCCTGGAAAATGCAGACGCTACCAGCGGCGAGCGGACAAGCCTCATTC
GAGGGAAGTCCGAGAGACCTACGAACGCTGAGGCGGAGTGGTTACACGCCCCAGACATCGGACACTTGGCAGCGGAGATTACAGCGGCAGCCCCGGTTGT
GTCGGGGGTCTGTCTGATTGAGCTTCACACCGACAAGCA