Description :
From Genome Similarity Track
Location :
scaffold_20:26590- 28179
Transcript NameFunction/comments
Pl_112103Major Facilitator Superfamily (MFS)

Sequence
1589 bases(100 bases per row)
CATCGACTTGCATCTTCCTAATGGGACTCTGGTCCAACGTGACGCACAATGTCTGGACAGCCTACGTCTTCACGCTCTTCTTCTGGTCCGCACGAAGGTC
CGTTCGTCAATGTGTCAATGTATCATAATGAACTCTTGACTCAAATTCTACTCTTTTGCCACCTTCCACTGCAGTATTTTGTTCCAACAGGTCGTAGCGG
GTTATGTCTTCGTGCTCACAAACTCCAATAAACCCGTGGGTATTGTCAAGGGGATCCAAGGCATCTCGCAGTTGGTCTTCTCGATTCCAGGTGGATACTT
CGCCGATCACATGCGTCGTGACACGATCCTCAAGCTCTCAGGTGCCATTGGTGTTGTTGGTGCTGTGATCACCTTCTTCTCCGTCGAAATGACGTCTCTC
ACTGGTCTTTACGTGGCATTTGGACTCTGGGGCCTCTTCGCGGCCTTCCAGAGCCCTGCAATGGAAGCTCTGTTTGCTGATTCCATCCCTCCTGGGAAAC
GCAGCTTCCCTTTCATGATCAAGTACAATATCAGCAACTTGGCACAGATGCTGGGTCCTGCGCTGAGCATTTTCTTGTTCTTGTTCTATGGAGACGAGTG
GCAATTACCGGAGCTCAAGCCTGTGTTGGAGTTTGGATGTGTGCTCGGTGTCATTGGCGCGCTGATTCTCTTCCAGTTTGATGATGACCGTGCGAAGGAC
TATTTGGTCGACAAGACCGAGGAGGAGAAGGAGGAAGAAATAATGCTGGAGAAGGTGATCACACCGTCACCTTTACGCACACCAAAGTTGGTTGGCAACG
GCAGTGAGATCGATATGGTGTACGATTACTCAGATGAGGACGATATTACAGTGGACGACAATTCTCCTCCTACAGCGACGGAAAACACAGCACTACTGTT
ATTGAAGGGCAAGACCGCCAAGGAATTGGATCTGGAACGCCAACAGCGTCTACAGGAGGTAGACGATGATGAAGAAGGCTACATGGCGAACATCGACGCC
AAGTTCCTCTGCTTCCGTACCAAGCATGTACCGTATCTTTTGTTCGTGTCGGACTTTATCATCAGCAATGGTGCTGGTATGACCATCAACTTCTTCCCAC
TGTTCTTCAAGGAGGAATACGGACTCACGCCAATCCACGTGTGTGCGCTGTTCATGAGCCAACCACTTGTGGTCATGATCCTGTCATTCCTTGCGCAGCG
TTTGTCTAAGCCGTGCGGTCGCATGCCGATCATTGCGTTTACACGCACTTTCTCCGTAGCATGTCTGTTCTCCATGGCCTACGCCCAGCCGATGGTTCTA
CAGATCGTGTTGTTCTTGATGCGTGGCGGTATGATGAGATGTTCACAACCTCTCCGTCGGTCAATTCTGATGGACTACGTCCCCAAGAACATTCGTGCGC
GCTGGAATGCTCTGGAGGGTCTGTCGGTGTTCTCTTGGTCAGGGAGTGCAGTGCTTGGAGGCTTCCTTATCGATGCGTATGGCTACCGTTGGTGCTTCAT
TATCACGTCATTCGTGTACTGCTTGGGTCTGAGCATTGAGATGTTCCTCTTACCGTTGACGAAGCATGCTGTTGAAAGATAGAGATAAA