Description :
From Genome Similarity Track
Location :
Scaffold_30:26577- 29325
Transcript NameFunction/comments
Phyca_LT1534507735Mitochondrial Carrier (MC) Family

Sequence
2748 bases(100 bases per row)
tgctttgcaccgcttgatcgctaaaacttcgtcttctttcaagacgaagacggaaactcgaaatggaatgcagcgactggttgtgtattttatgccaaag
accaacaagaagcggaaacgatcagaacctcaatcgtaccttcggttcgtgctccaaaaggtaacacttcttatcatgttactgtgtttccttaccgata
ttaacccagtcattttgtagacgaaccaagagcactttgcgtgcttcgacaagcttgctaggcagcttcatcgcccgctttcggcattttcatacgcagg
gacgaaagacaaaaacgccgtcacctatcagcatgtcgtggtgactggagttacgcctgatcgaatcttgaaagtcaatagcgttgaaagtgatgcaacg
ggtatacacgtgggagacttgaaatatgtcgaggcaccaatgtctttggggaaagcgagcggaaacagattctcaattgtgatccggtatctttcgtctg
ttacacattgcactaccaagatgattcgatcatgccttgattcagcactggtaaacattacgcgtatgggatttatcaactactttggcttccagcgcgt
tggactgcctacgaacgctgtgagagcccaccatattggcgagaaaatcatcgctggcaagtggaaagaggccgtgcgccttctcttggatattcaggaa
ggagattcggacgatatcgcaaaagcaaaacagctttatctcgaagctggcgatgttgaagcggctctgaaacttatgccacagggaatgtctgtcgaac
ggcaacttcttcaggggttaaagcgctatggagacgattcgtttgaacaggcgatccaaggcttgtcgttttcgcgtcgtgtgatgtacatgcatgcgta
ccagagttatctctttaaccggatggcgtcgtacagattgcgtcagtatggacctaaagttgtggaaggtgatttgattcactgtggtgacgagggctct
aaagcagtgaaagctgttactgctgttgaggcggatgagttaaatagttcgcgtgaggatgcactttcacttgtgcttttaccactacccggaaccaacg
ttacactcccatccaatgcaacccaggacgcttatattaaggttggttgcaggtcctgtccaacaagtatggagttttctaacagtttgttgtgtacttg
cttagatgatggaacaagatggcacgagaaatgctttacgtgaatctggacccgtgaaaggagcttacaggtcgttggttacataccctcgtgatctgga
gtggacttggcaagaagagcaagacaattgtacgtatcgttgcttttgtacgttactttcgtttgactaacccttgcttcgctttacagcgctttcgctt
caactttcgttctcactcgatagcgggtgctttgctaccatgtgcctacgagaagtgcttcactccgacatctaggatccacttttccaatgagaaaaca
ttgatcatgcagtcaaaagcagcgttcaatttattattccatccggccgaaccggtacattccgaggcattgctaagcttcctcagcaacgacggacaac
gcatgattctagttcttcttggcctccatatcctccagcgcttgacgcacgagcttggcacccgtgaccatgaagagcgtctgccaaatccccagaccca
gacgcggcacaatgcccttgaagaggcctccgtagccctgctccttgatcaccgtgcggaacacctgcaccatgttctgcttgggctcgccgcggtcagc
agcactctgcatctggatgcgtgccacctcgaaaggatggttccaacaggccaagcctccacccacaataccagcaccagcctcttgagccactgtgagc
ttagcatccttatcaccgtgaaacaataccttgaattgaccacgcacaatctctgtgaagccctggcgagacgcccagttggtggcctggcggaaggcga
tggcagtgccgccagggtagaagcccttaagaccgtgagcgccgtacacgttgtggatacgctgcatggtggagatggaacggtcgcccgtgacagcgcc
cgtcaccaggaacgtgcaggggcccatgaccacgacctggcacacaccaccgccagcaccggccagaaaacctgtggcactctgtcccattcctgcagac
agcagcgagtcggagatagcttccttggagaagagcagaatggctcccttggacgcagactcgaccatcttggggcctgttccagcccagaaagcggaga
taccgccgccctcacgcatcacgttgcggaacgcctgcaccgtcgactccgtgcggtagcggcccatgcgcgttttccagacctcgaagggcatgccgag
cgtcgcggcctccagacactgcagcaggccgccattgaacaggtcacgtggacccactttcttgccggacgcaggcggaggagacatcgagcaggaggaa
ctgggggcggactcggcgaatcgagatatgacgcagatctctgagtcgatttagggggaaagccgagacataacgcgtttggttcaatagcatggaagat
gtcctaaggtttatatgtaaacgtggaagagattaggatatcaggagtacagtagatgatagagtgtttgcgtgtcgatctacagcttcgtatttggctt
cgtgacgtcacgccgtcggcaccactggaagctcgagggcgtcagcca