Description :
From Genome Similarity Track
Location :
Scaffold_1:2657288- 2659252
Transcript NameFunction/comments
Physo_474436P-type ATPase (P-ATPase) Superfamily

Sequence
1964 bases(100 bases per row)
CGCCAGCGCCCATAGTGTAAGCGTACACGTACTGGTTGTACGCAACCTCGGCCGACGGCTTCGCGTCGTTCGGCAGCGAGTTGAGGTGCACGTCCGCCAG
GTCCTCGAACAGCTTCGAGCGCGAGTCGTACTTCTCCTGGTACTGCGTCCAGTACGCGTCGATCGCCTTCTCACGGAAGTCGCCCACGTCCGCGATGCTA
GCGGCCTGCGGCACGCTGCCCGTCATCTCACCACAGCCCGTCGCGTTGTTCTCCATCACGCACGTCTGGTACTGGTCCTGGAAAAAGTCGTGGCACTCGT
TCTTCATGCAGCTCACGCACAGGTTCTCCACGCCCGTGCTCTCGAATCCGCTCGAGTTGTTGACGATCGCGAACAGCACCACCGTCGACAGCGTCAGCCA
CAGGCCGAACGAGATCGACGAAATGAACACCTCCTTCAGCTTCCACGAGTCCGGGTGCGGCGACGCCACCACGTTGTCCTTCGAGATCGTCAGAATGGTG
CCGTCGTTCAGGATGGCCAGAATCACAACAAGGATCGGAGGGAAGTACCAGTTCCACGCCACCGTCAGGATGCCGAACGTGAACACGATACGCACCGTCA
TGGCGATCGAGTACATGGCGTAGTTCTTCATGCGCAGGAAGATCTCGCGGCTCATGCGGATGGCCGTGATGATCACACTCAGACCGGGCGACACAAGCAC
GATGTCGGCCGCAGCACGCGCAGCGTCCGTCGCATCGTCCACAGCAATACCAATGTCGGCCTGAGCCAGGGCCGGAGCGTCGTTCACACCGTCACCCGTC
ATGCCCACCACCTTGTCCAGCGACTGCAGGTGCTTCACGATCTCGAACTTGTGCTCCGGGAACACCTGAGCGAAGCCGTCCGTGTCGTAGATCATCTGCG
CCAGGTTCAGGCCAGGAGGCGGCGCAGTGTTGAAGAAAGAAGTGTCCAGGATGTTCGTCGGCATTCCCAGCTGACGGCACGTCTCCACGGCAATGGCCTT
CTGGTCACCCGTCACCATCTTCACAGCGATACCCAGAGCAATGGCCTTCTTCACCGTGTCGGCCGTGTCGTGGCGAGGCGGGTCGAACAGCGGCAGCAGA
CCGATCATCTGCCACTCGCACTCCTCCACCGGAACGTCGCCGCTGCGAGAAATACCCACACCCAGACCACGGTACCCGCGCGAAGCGAACTCGTTGATGC
GGTCCTCCACCTCCACGCGCAGCGTGTCCGCGTTCACGTCCATGTCCAGCACCACCTGCGGGGCACCCTTCACGGCACGCAGGATCTCGCCCGTGCGGTT
GTCCTTCAGCTTGGCAATCGTGCGCTTCGTCGTGGGGTCGAACGGCGTGTAGTGCAGCAGAGTGTACTCCTGCCACATCGTGTCCTTGCCCGGGTACGTG
TTGTGGCACACCACGTCGATGGCCTCGTTGTTCTCCGTACGCGCCGACAGAGCGCCGTACTTCAGGATGTCATCCGCCGTGAAGTTGTTGTACGGGATCA
GGTTGTCCATGTCCACCGAGAGCTGGTTCAGCGTCAGCGTGCCCGTCTTGTCCGAGCACAGCACCTCCATGCTGGCCATCTCCTCAATGCACGTCAGACG
CGTCACGATGGCGTTCTCCTTCGCCAGCGCCGACGAACCGATGGCCAGCGTCACCGACAGCACCGTCGGCATGGCCACGGGGATACCGCCCACGATCAGC
ACCAGGATGTTGGCCACGCCCAGGCAGCCGTCCGTCACGATGACGCACGGGTTCTGCGACGTGCGGCCGGCCATCTGCACCAGCAGCTCCACCACGCACC
AGAACAGGATCGACACCATGCAGAAGTTGCCCACCGTCGTCAGCACCATCTGCAGACGGCCGTGCGAGTCCGCCGTAGCGATCTTCTCGGCGGCGCGGCC
CAGGAACGTGTTAATGCCCGTGCTCGTCACGACGGCCTCGATCTCGCCCTGCTTCACCACCGAG