Description :
From Genome Similarity Track
Location :
Scaffold_56:26572- 29455
Sequence
2883 bases(100 bases per row)
GCGAGTGTAACATCCCGTGAAGAAGTGGATGCAATATTGCTGGCGATCGCGCCACGAAATCAACCAAGGCAAATTATAAGTATGCCACCACCAAGGTCTA
AGTAGGTAAAAATCTTATGGTCGTCGGCTCTATTGGATCGTCCAGGGTAAACAGAAAGGGTGTTGCTACAGCGTAATCGTAGAAAAGATTCTTGGGAGGA
CAATCGTAGCTGCTGCCTCTGAATATGCAGTGAAACTGACGGTGATCGAATCGGAGCATCAGGGAATGCTGCTAGGTTAGGATTTGCTTGCAGATCAGAC
CAGGGGGCGCATGATCATTTGCAGTGACTCAAATTTGGTAACTCGACAAATTCGATTGTGGTCCATCTATGGCTTCCGGTACATAAAGCGGGATTGGAAT
TATTGTACATATCGACAAGCAAGTTAAAAAAAAATTTTACAGAGAGAGAAGAGTGAGTCGTGGTTTCGGACCAAGATCGCCAGAATATGAGCACACTTAA
TCAATTGGATGATTTTTTGCAACCGAGTAAAGTCGATCAGACAAGTCAAGGTGGTAGCGATCACTCGATAGTCCATGCTACAGGGTCGTATGCCTGCGGC
CTTGCAAGAAGAGACGATACGGGAAGCCTGGATCGAACGCATAAAACAAGCGCAAAAGGAAAAAAGGGTTATATCCGACTTGACGTCGTATCTGATCAGG
GACATCGCCAGTTAAATGCTTGATCTGCAGAGATTTGTGCCCTGATTGCACCCGATTATTAAGTAGATCATAGTACATGGTTAATTTCCTGTCCTAGGGC
GGCCAAGAATCGGAAGATCGGTTCGTTTAGGCATTCCTGATCTATTTCAGCAAGATGTTCTACATCACTATAATACTAGCTTGGAGGGCGGACACCACGG
CATAAATACCAAACTGATCAATGGATCAGGGCTCATTTCCATTTTCGAGGACTGTACTTGAGTGTGTAATGCTACATGGGCGAATTTTTCGATTGCGAAA
CGGGAAAGGGACGACCACACGATCAAAATAAATCGTTCGGCAATTTACGTACAACGTATACATTCTAAATTCTGGCAATAGATCACATATCATAGCTTTC
GCATTCGTTCGATAGGAATATTGAGCTTTTACTATAGGCCAATCTGTTCTTGGTCAATGTGATTGCGAAAGCGAGCTCTATTGAACTATACAAACTATCG
CCGAAAAACTATGAAGAATGTCTGCCTAGAAATTCGGTGCGAGCGAGGCTATCCGCTACGATCAGGTATTAGGTTTAATGTCTAATTTAATTCGAGATTG
AACCAGATCTCAGGTCAGAGACAGCATGCAAAAATGTAGTATCGGCTTCAAGCGAATAAAACGTCTGAGCTTATGGTGCAAACTTTGACGCGAGCGATCA
AGATGTATGTCAGGGGCAAGAATTCACAATCCTAGGACATATATGGGGCACGATTAAATTGTGAAATTAACAATTCACAAGATCTTGTCAAAGGAGTCAC
AAAGTTTTATTTTGTTCATGCATGGGATCCAAGATCGAATAAAAAAAGGTGACCCCACCATTCATTAGACAGTGTCAAAACCAGCGATCACAATCCCAGG
AGATCGCGGTATCGCATCCAACGTCAAAATCATCGAGCAAGAGCCGTGCTGGATGATCGACTCAAGATTGCAATCTAGAATGAAGCTGATCGCCACCATG
AAGTTCACGATCAGCTTGAGATAGATCGCGGATTAAAATTTGGTTGTACACAGATCGAATTAAGGATACATATACGCGATAAATAGCTCATGTGTGGCAC
GGGCCATTTCGGGACGTAGATCGATGCGGCGATCACGTGGTACAATTGAAGATTGTAGGCCAACCTTTAACGGATTTTCCCTGTTATATACATTATCAAG
TTGAAATAGACGAAGTTATTATCACAACTCCCAAACGTTTAAAGATGGTCAAAATTTATCCTGGTAATTTTGATGAAGCTCTAAGGCCGGAATACAACTG
GGAGAGCGATCAAGAAGAGAAAAAAAATTTGAAGTGGAAGAAAATGCAGATATGCTATCAGGTGAAAAGACACGCTATGGTCGTGTATTTCGTCAATCTC
TGGTATATTGGACGGTTTATATAGATGATTCATGAGTGGATAAGGCAGTCTTAAACTGCGGCGCTTTGGTATAGGGATTTAATCGCGATCGAACTAATCG
AAACCGCATTTAGGTAATGCAGCCACATGAAGAAGGGTCGATGACTATCATCGATCGGGGTATTAGTATTGAAGAAAGTATGCAGGGAGGTTGCATATAG
TTATGATCTTATAAAAGGTTAAACGGCAGTAAGAAAGGTTTAAAAAGGTTGTTCATCCGATGAGTATGGCGATAGGGAATGATCGCGGTCGGTATGATTA
TAAAAGAAGACAATTTCAGATTTGATGTACTAAAAATGATATGATGGAAATGGAATTTAATTTTGAAAATGGAATCGAAATTGAAGGATTATTTCACGAT
TAACTTACCGGTCAATCAACGGATTGAAGGTCCTGGATGATCCGCTACCTTAATTTTGGATGCGCCACGGACCCGTGGAGTTTGTCTCTGGGGCGAAGCA
GTGGCCAGCTTGGGATGTTACCTAGCCTACACCCCAGTCCAGGATACCAGAGCTACTTCTCGTTTGGACGAGGAAAGTTCAGGAAGATTGATTACAAAAA
TAAAATCAATTCAAGATGACCTTCGATCAAATCTTGAAGTTCAAACCGGAGTTTCGTCTTCCAGCGAAGGCCGAATCGCAACCTTCGCTGCTTGCGATGT
TCGTAGTATACATCTAGGTCCGTATCACGAGCATGATCCGAAGCGGTGTTAGGAAACCATGTGGGTCGATTCCCACAATGCCT