Description :
From Genome Similarity Track
Location :
scaffold_1410:2657- 3808
Transcript NameFunction/comments
Pl_100723pectate lyase

Sequence
1151 bases(100 bases per row)
GTCGCTGCAGACGGCTCGTACGCCTTTGCCACTGTCGCCGCGGTCGTCACGGCTGATTCTTCACTCTGGCCGGTCAACTCGGCGTCACTGTTCACCACCG
TGTTCACGATACAGTCGCGACCGAGGGCCGACTCGCAATACGACTGCGTATCGCTGGTTGGTACCATGAAAGCACCAGTGGCGTCGTCGTCCAACAGCAC
GGGCTCCGTGCACGTATCCATGTAGTTGCCTTCCGCCACGGTGTAGGACTCGTCGGTGGGGTCGAAGTTGTGACCCGAGTTGTTGTAGAAGTAGTTGTTG
GCCGCGTGCAGGATGGTGTTACCCCCAACCTTGGGTGAGCGGCCAGACGTCTGGTGAATGTAGTTGTTCACGAGACTCACCTGCGTCTCCGTCCCGTAGA
AGAGCATGGTCCAGTAGTGGCGGTTGTCACACGACGCCGAGTACTCCGTGTAGCCGTCAAAGTCACAGTTGCTGATGGTCATGCTCTTGACGCTGGCCGT
GTTGGTGGCGATCATTTGGCGACCGATGCTCGAGATCTTGACGTGGTCGAACCATACATTCTCCAGTGCGGTCTCACCTCCGTCCGCACCCTGGATGTAG
ATGGCATCACCACCCCAGACCAAGTGCGGATTCAGGTTCGTGATGTGGATATTTTGCACGATGACGTTGCTACCGAGGATCCACAGACCCTTACCGATGA
TCACACCTGACGTGCCAATGCCTCGGATAGTCTTGTTGCCCTGCACTTCCAGCGGGTTGGGACCAGCGTTGTCGTAAGTCACCTCCACCGAGATACCGTC
GGTGCAGCCACCCGTGCCAGACATGCCGCCGCTTTGCAGAATCACGTCTTGACCCTTGCAACCGTTGTTTTTGGCGATACACTGCTGGTTGGACAGCGGA
CGACAACCATCCTCCGTCGTGGTCCCCTCCGACCCGCGGTAGTCGAATTCCTGCTGCAGGATGATCACGCGCGTCTCATCGTCCGAGAGGTACGAGGTGA
GCTCGTCGATGGTGGTCGGGTAGACGGGATCAGTGTCACCACCGCCGGTTGCACCGGAGGCGAGACCGGGTGCAGTGCCGGTGTTGATGGCGACGGTAGT
GTGTATGGCGAGCACGAGTGCGCCGATAAAACTGAAGTGGAAGATCTTCAT