Description :
From Genome Similarity Track
Location :
Scaffold_2:265669- 267478
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001078Similar to DDB_G0287625: Uncharacterized protein DDB_G0287625 (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G001077Similar to Exoc4: Exocyst complex component 4 (Rattus norvegicus)

Sequence
1809 bases(100 bases per row)
GAGACGCCCGAGAGCATCCGCGCGCAGTATGCGAGTCCTCGCGGCGAGAGCGCCGACGAGCGCCGCAAGCGCCTGACGAACCGCCGCGCCGCCAAGTACC
GCTACTTCAGGAGTCTCGACATCCTGCAGGGCCTGCGCCGCGAGAAGGACAACACACGCCAGCGCGACCGCCGGCGCCAACTGGACGACGCCACCAAGTG
CCGCGTCCGCGAACAGAACCGCATTCGCCAGCAAGTGCGGCGACAGACGCTCAGTGATGCTGCCAGAGAGGAGATCCGCGAAAAGCACCGCATGCGCCAG
CAGATGCGCAGACAGCGGCTCGATGACCAAGCACGAGACGCGCTGCGCGAGAAAGAGCGGCTCCGCGTGCGCATGCGACGTGCGCGGGAGATGAACGCCA
ACAATGATGGGCAGCACTCTGGAGAAGAGAAGATGTCAGTACCTAGACCGCTCCCGCTTCCATTATCGCCGTTGCATCAGGTGCGGCCGGTGCGCAATGC
GTTGAACCTACTGACAGGACACCATCAACTGCTCAATTCGATTCAGCTGCCACCAGTGATGGCGAGCACGGTTTCACGATCGGAGACGGAGCTCCCGAAC
TTGCAACCGCATTTACGGCAGATCCAGCAGCAGCAACAACAACAACAACAACAGCATCAGCAACAGCATGCACCGTCGTTCAGTGGGTTTCAGTTTCCGT
TGCCGTCGGCGTCATCCTTCCAGTCAGCGGCTTCGTCCAATGGGTTTCCTGATCGCATCCCGCAGCTCCCGCACCTACAAATGGCGTTACCTCAGGCGTC
ATCTTTGCTGAATCCTCCACCACCTCCGCTGCTGTTCCACTCGGGGCAATTGGGATCAACATCGTCGACAACGAGCTTAACCGCTGGACTGTCAGGACCA
CCGCCGGCTACTGGACTCGCTTCCATTTCATCGACAACGGTCTCGGCTGCTCCACTGCCGCCGACACAGCAACTGCTGCCGCCGCTGGCGCTGCCACCTC
CAGTCCGCGCACTTCCTCCGCTGCCTGATTTTCTCAATAGCCGTGAGGCGTTTGACCCAAGTACGACGACAACCAGTGCTTTCTTCCCGTCGATTGGGGA
GCTATCGAATGACTACCAAGATGGAGAGACGCCACTTTTCAGAGGATAAAGAGCAGGTGATAGAGAGGTGAGTGCATTGCATGAAGAAAGTGAGGCTACT
GAGGCTGCGAACTCTACTCTATCGCAAGATGCTATCGAGTTTATTGACGCTGCCTTTGTTCAGCACGCGATGCGGGGTGTCCACTCGCCAGAGCGCTTTG
TACACGTCCGGGGCGTACGTTTTCCGATTATCGAGCAGAAATACCTCGAGCTGCGTCTCCGAGAGGTTGAGCAGCTGGTAGTAGCGCTTGGCGTGCTCAA
ACTGATACCCCGTGCGGCCGATGCTCGGATACGAATACAAGATGCCAGTCAAGCCCTGGTGCAAGGCGCCAATGTTGAGCAGCATCTGCTGTACCCCTCC
TTTCGTGAACTTGCAGCCGTTCATTTGCTTCAAGTTGCAGATCAGGATGTTGGCCAAGAGCGCATCGATGCCGTCAAACGCCAGCGCCATCTTGTCGCTT
GACAAGTACGGCTGTAGTGCATTTTCGATCGACGAGAGGTTGATGTTGAGAGAAAGCACGCTGTCCTGCGCCATGGTGACTTGCTCCTCGGCCAAATCGT
ACCGCTGCGAAATCAGTTGCGTGAGATAATAGAAGCAATGCAGTCGGATCTCGCGGCGCAAGAAGAAGAGACACTCGTCTGCTAACGCGCTACAGCGCCA
GCTTGTAGC