Description :
From Genome Similarity Track
Location :
Scaffold_1164:2656- 3720
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1164-snap-gene-0.4Novel protein

Sequence
1064 bases(100 bases per row)
GTGCAGCTTCGCGAACACGAACGAGGTGCAGTCTTGGAACGCCCGGATCAAGCAAGACAATATCTTTGACTTCGTCGGCGTGCTCTCCTTCGCTGGCAAG
ATCTGTCGGCGGCGTAAGCGAAAGCGTACTTCTGGAGACGATGACGGTGAAGAGAGCGGACCCGTGACAGAGTACCGATGGATCAAGGCTGTGAACGAAC
ATTCTTCGACCGAGTTGACCATCCTGCTCCACGACTGCTCGCAGCCTCAGCAATTCCGCAACCTCAAGGCTGGGGACACTATCATGCTCACAAAGCTGCT
ATGTGTTGATGAGGGCGAGACCAACGCGGACGTCAAGACTGGCGTGGACGACCACGTACTTGGCGCGCAGTACGTCACTTGCAGCAGCTTCACGGTCATG
CGCGTCAATGACGCAGTCTCGGCGTTCAACACCAAAGAAGAGTGCGCTGCAAGCTTCAAGCTTGCAATGAAGCTGGTGGCAAATGCAAAAGTGCGAGAGC
AGAGCTCCACGGGCGAAAGCTGGCTCGAGGGTGACATGATCAAACAGGATCCCCACTCGCCTCAGTCTAGCGACATGCAAGCACCAGACGCGGGGACGAC
GCCGCCTTCTCTTGGACGTCAGCCCTATCAATTTGGGTGAGTTGTATAATGATATCTACGAACGTCGTGTTAATAGTCTCGGTTACTAACCCACAACTTT
GTTGTTTCACCAGCGAGTTCACAAGTGTCTGCGAGAACCTGGAAGCACTGGAGCACCGTCATGTTGCTGTTGTCGGCCGCCTGCTCGCGATCCCAACGCT
TTATGATGAAGATACTGTGTCGTCACAGCAGCCTACAGTTTGCGAAATTGAGTTTGGCGACACTCTCGACAGCAAGCAGTCTCAAAAGGTGAAACTGCGC
ATGAACCCGGTCTTCAGGTCCTTGGACCAGCAAGCATCCTCCGAGAAAGCTGCAATCCATGACATCAACAGAGTCACTTCGAAAGCAGCGCAGTGCTTGC
TGGAAATGCTGTCTCCAGTGATCGTGGAGGAGTTGCTTGCCGACGCATCCAAGAGCATCAGTGG