Description :
From Genome Similarity Track
Location :
Scaffold_74:265570- 268028
Sequence
2458 bases(100 bases per row)
AACGTGAGTTCAACTCTGGCAGTGAGAACGAAGCCGAGTCCGAGGGCACGCACGATGCTCCTGCGGGCTCTGTGGGAGGGCACGGCCCAGTGCCCAGTGA
GCACAAGGATGACAGCGTGCAGTCGCTCGCTAGTGATCAAGGTGATCATAGTCCCAGGACGTCTGTGCGCTCTGAGAGTCCGGCCGTCAAGGCTAAGGGC
GCTCCCAAAGCCGGTGGCGATGAGGAAGAGAATCCTCGCAAACGTCTCTCGCTTGCCGAGGGTCTTGCGCGCGCTAAGGCCTCTAAAGCCGAAGGCGCCA
AGCCCTCAAAGAAGCGTACAGCCTCTAAGTCTCCACTCCGCGAGGAGAAGGAGATTCAACACTCCTATCAGAGTATCTCCGACTCCTCGGGTGAAGAGGA
GGAGAAGGAGGAAGAAGAGGAGGAGGGTGCTATTGCTGAGCCCCGGGAGGTTTCGAATGACCTCGACCAGCAGCAGGAGGAATTACAAGCTGCCCAGCGT
GTGCGTGGGGGTTTGGTGGTGGCACCCGTCAGCCAGGGAGCTACCATCAACTCTAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCT
TAAAGATTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGCCACACTTCTAGGGGCATCTACGAACGTGCCCTTGTTCAGAAAGAACAGTTGTTCGCTGACAA
CTTGGAGGCTGCTCGGTGCGTGCTTCTCGCGCCACACCGAATCCCTCTTAAGGACTTCACGACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTAT
CCTCTTTGGGGGTACCCCTGGGTTATGCCCGAGAACTGTCCCACGTCGAGTTCTTGTGAGGACATGTTCTGGGCATGGGTGGAGTCTCCTAAGTACTCAC
CCTTGGAGCTACGGGAACTCCATGAAGATCAGCTGCTGTCCCGCATCCTGAACCAGCGTGATCTTCGTGTGAGGTTTGCCACTTGATCAGCAAGCGCATG
CTGCCAAGGGCAATCCTGAAGCGCGCGGCTTCTAGCGCTCACGATGAGCGCGGGTACGGAATGTATTCATCGTTCGTACCCCGTTCAGGCAAGAAGCCCC
GGACTACCTATGAAGCTGCCGCCGCTTCTGTTCCCAGATTGCGACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGCTCTCGATG
TGGGCATAACCCCTCCACTTCACGAGGAGCTGTCGCTTACCGCGACACCGTTGCTCCTAGAGGATCCGCTCCACGTGGAAGTGGACTTCGCCATTCCGGT
CAAATAGGGGCGGAGGTGCTCTCGTTCGAGTACGAGTACTCGGCGCCTCCCGGGAGCCACTCTTGTCTGAGTGCTCCGACGGCGGGTCCGACACAGGACC
CTGAGGTTGACTGCCTCCGTCAACGTGTCCTCGTGCTTGAGATTGCACTTGACCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGG
CTCGCTCGTCTTGCGGGCCGCCTAGACCTGTTGGAGCGTGAGATTGCGAGCCTGCAACTAAGGCTGGATCACCGGGCCTCTTCGTCCGATCTGGACGAGG
CCTTTCGCATGATTCGACGAATCGAGGCTCTGCTGCCACGTCCGGAGCCGCCTGCGGCACACTCTCAGACGTACGCGTATGGTGCGTACCCGGCGTACTC
AGCGTACTCGGCGTATGGCGCTGGGGTCCGTTCGTACGGAGCCCTTCCGGCGTACGGTCTTGACCGCAGCCTTGCTGTTCCGACCGAGGCGTGGGTGCCT
GCTCCGACGCCCTCGTCGACGTCTGTGACTGAACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGGGGGCGCGTCATGCGCCTCC
GCGAGGATATCGAGCTTCAGATTCTCGTCGTTGGGTACGACCACACGTGGAGGTTCAATGGGCTCCACCCGGTAATAGAGGAGGCCATCCTTCAACTCAT
ATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCAGACTTCGCGCTCGTTCCTGCCGTGAGGAACTTGACTATAGGCGCGACAGCCTCATCGTC
CCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGTGTGATGTGAGCCAACGCATAGTCGGGACGCCGAGAGAGGGCGTCCGCAAGCACG
TTGAGCTTTCCCGGCTTGTATTCGACGCGGAAGTTGTATTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCCG
TCCTCAAGGACGCGTGGTCTGTGTAGATCACAGAGGGCCTCGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTT
GTCGTGGAACGGGTAGTTGCGCTCGGCGGCTTTGAGCTGCCTGGACTGGAACGAGATG