Description :
From Genome Similarity Track
Location :
Scaffold_1:2655597- 2675291
Transcript NameFunction/comments
Phyin_T30-4PITG_00499ATP-dependent RNA helicase dbp4%2C putative
Phyin_T30-4PITG_00500Putative uncharacterized protein
Phyin_T30-4PITG_00501Putative uncharacterized protein
Phyin_T30-4PITG_00502Putative uncharacterized protein
Phyin_T30-4PITG_00503Rab32 family GTPase%2C putative
Phyin_T30-4PITG_00504Putative uncharacterized protein
Phyin_T30-4PITG_00505Ubiquitin carrier protein
Phyin_T30-4PITG_00506Syntaxin 7-like protein
Phyin_T30-4PITG_00507Putative uncharacterized protein

Sequence
19694 bases(100 bases per row)
CCAGCCATTCGAAGAGCTCCACAGTTAAAGTCATGGCTTCGCGTGCGTTCCGCCAGGCCCATCCTCCGGTGCAAGACGAAGAAGCCGCAGCCGCATCTGC
CGCTGCAAAGCTTAAACAGAATGAGCGCGAGCGCCTCGAGATCGAGCGGCTAGAGGCGCGTATTGCTGAGCAGACGCCTGCACGAGGCTCCCAGCTTGGT
GAGGCCGCCAGTTTCGATCTGTTTCCGCTATCTGAGGCCTCACGTCGCGGTCTAAGAACCTGTGGCTTCACTGCTCCTACAAAAATTCAAGTCGGATCTC
TACCTCACGCACTGGCGGGACGAGACGTGCTCGCAGCAGCTAAAACAGGCTCAGGAAAGACACTTGCATTCTTGCTACCGGTACTGGAGAAGCTCTTCCG
TCTCCGTTGGAGCGTGGAAGACGGACTTGGAGCACTCGTCATCGCGCCTACACGAGAACTAGCGTTACAGATCTTCGAAGTGCTGCGTAACGTGGGCAAG
GCGCACGCGTTCTCGGCAGGTCTGGTCATCGGTGGCAAGAACTTCCGCGAGGAACAGCTCCGTCTCATCCGTATGAACCTGCTGATCTGTACGCCAGGTA
GACTGCTACAGCACATGGAACAGACGCCTGCCTTCGACGCTAGCAACCTACAGGTGCTGGTACTGGACGAAGCCGACAGAATCCTGGATCTAGGCTTCCA
GAAACAGTTAACGTCTATTCTAGAGCATCTACCTCCCGCAGGAGAACGACAGACGATGCTCTTCTCAGCTACACAGACTAAATCTGTCAAGGATCTGGCC
GCGCTGAGTCTGCGCGAGCCAGAGTACGTTGCAGTGCACGAACACTCGGCCAACGCCACTCCTAAGGGCTTACAACAGAGCTACGTGGTAACGCCGCTGG
AGCGCAAGCTGGACGTGCTGTTGTCCTTTATCAAGTCGCATCTTAAGCAGAAAACCATCGTGTTCTTGTCCACATGTCGTCAGGTGCGCTTCGTGCACAG
CGTCTTCTGCAAGTTACAGCCGGGTATCCCTCTCTGTGCGTTACACGGCAAGTACAAGCAAGGCAAGCGTGTGGAAGTGTACTATGAATTCTTGAACAAG
CCAGCTGCCGTGCTTTTTGCGACAGATATTGCAGCTCGAGGTCTAGATTTCCCTCAAGTCGACTGGGTATTGCAGCTAGACTGCCCGGAAGACGCAGCCA
ACTACATTCATCGTGTCGGTCGTACAGCGCGATACAATAAACAGGGGAAAGCTCTGATGTGCCTTGTGCCGTCCGAGGTGGACGGCATGATGAAGCGTCT
AGAGGACGCCAAGGTGCCGATCCGGGAGACGAAGCTCAACCCAACAAAGACCTCGAGTTGTCGTCAAAAAGTGGCGTCTGTCGTGGCAGGAGATAAGGAG
ATTAAGGCGCTGGCACAGAAGGCGTTCATGTCTTATGTGCGTTCGGTGTACTTGCAGCCAGATCGTGAGGTGTTCGACGCTACAGCTCTGCCTCTAGACG
CATACGCTGAGTCTCTGGGTCTTCCAGGTGCTCCACGGATGCCGTTCCTGTCCAAGATGAAAGCTGAGCATGAGCAAGGAGGCAATGAAGCTTTACGTGA
GGAACTTCGCGGTAAGAAGAACGTGAACCGAAAGTTGCAGCAACTTAAGGAGAAAATTAAGGCCGAGAAGGAACGTAAGCGGTTGGCACGGCAACTGGCT
GCGTTGGGTCCAAAGGAACAAGAAGCAGCCAAGAAAAAATTGGAGAAACAACATGAAGAGGACGAGGAGGAGGAAGAAGAGTCGCTAATGGTTGTCAAAC
GGGTACACAACTGGGACGACGACGAGCCGCTGGACTTGGAATCACTTGGCCCTAGTAAGAAGATTCAGAAGAAGCTGCGTGTGGACCGTGAGGTCATCAA
CGCTTCGAAGATCGTGTTCGATGAGGAAGGCAACAGTGCCAAGATCGCAGACCGTCTATCGGCGCGTAGTAGTGCGGACACGGAGTTTGCGGACGTGGAG
CAGCACGCCAAGAACTACACGGAACAAGTGGCTGCTCGACTCGCTGCTAAGGACGAAGAGGATCGTCGTCTGGAGAAGGAGCGTGTGCGTGCCAAGCACC
ACAAGAAACGCATGAAGGTTAAGGGTGAGCGCGACGACGAGAGCGAAGACGAAGGTGCGCGTCTTGCCGTAGCTTCAGACGATGAAGATATGAGCGGTGG
CAGTGAGAGCGACAGCGAGGAAGAGGCCAGCAGCGACGAAGACGAGAGTGACAAGAAGAATGTCGACCTCCAAGCTGTTGCCAGCCAGGAAGAAACGGCG
TTGCGCATGCTGCAGCGTCATTAGATTCTGACAAACATTCTCGAACTACCGTTTACCCATTTCTTTTCGATAATAGAGTCGTCCACTATGGTAGGACTTT
TTTTTCTTCTGCTTGGGTCATTCTACATTTTAAGTCTTAGTTCGGAGCGATGGCGGATGCCACTTGCTCTCCTGCCAAGCACCCTCTGCATCGCCTTCCT
TCCGGCATGCGTGTACCCACTGATTCTCCATCACCTTCTCGTCCACGTCGTCGCCGTGTACGCGCCGTGGCTATGATCCTGGACGACGTGCTATACGACC
ATTCAAAGCTCTTGTCGCATTTGGCGATCGACCGCGGCGTAGCTCAATTGCTGTCGGAAGGCGCGTTCCCAACAAACGCTGCCGCTTTCGAAGCTCTTCA
AACCTTCCGCAATGCTTACGGACTCCGTAAACGCTTCCCGCGCTTCGTTGATAGCCTCGTGAGTGGCCCACAGGCCAAACTATCGCCGGCTCAAGCGCAA
CGCGTCATCACGGCTTACTATGAGAGTAATGTACCGGAAGCACGAAGCATCACGCCATTCGCGGGTGTACGCAAGACGCTAATGGAGCTACAAGACGGCG
GTGCCTGTCAGCTAGCGCTGTTATTGATCGGTAAGCCGGAGGTACAACGCGAACGACTTAAGGCTCTGGGAGTCGAGGATCTGTTCAATCAAGTGGTATA
CGTGAGTTCCAATCCAAGCTTGGCGCAGATCACAAGCGCTATGAAACAGCTTGCGAGGCAATTACAAGTACCATCGTCTGCCGTCATGTTCGTGGGTCGC
AAGGCGTTCTACGAGATCAAAGCGGCGAATACTGTGGGAATGCTCACTGTCCGCATGGTACGTGGAGATCTTGAGGTGATTTGAGGGGTGTTTGGTTAAC
CTTTAATGCACTGTAGCTCTTCGGCAAGTACACGAGCGTGATGCCAACGGACGAGATGGAACAGCCCAACTTCCAGGTAAGGAAGCTACTTGATAATGTC
TACTTATGTGATACTGAGCAACATTTGGTTGTGCTGTAGATCGAGTCGATCGAGCAGCTTCTGCCGATTGTTAAACTGGCAGACCAGCAGATGCTGCAAC
CTAAGATCGTGGCGATTGGTGGCGGCACGGGTTTGGCTGTGCTACTCAAGGAACTGCGCCACTATCCTGCTGATCTCACTGCTGTCGTCACCGGTAGGTG
TGCCGACTTAACTGCTGTTAGGAAAAGTAATTAACTCTACGTTTCCCCTTTGTAGTATTTGACTCGGGTCGCCACTCTGGTGCGCTACGCAAATATCTTG
GCATCCTTCCACCCGGAGATATTCGCAATTGTCTCGTGGCGTTGTCCGACTCCGGTTCGTACTTCTTTACCCTAACGAATCTCACGCAACGTGTACTTAC
TCTGTCCACCACTTCTCGTTTAGATGAACTCTTGAGCAAGTTGATGAATTATCGCTTCCGTGACAACTTCATGGAAGGCTGCAGCTTAGGCAACCTGCTG
CTAGCTGCGCTGACCGATCTACAAGGCGGTTTCGACCGTGCTATCTCGTCCATCTCCGACATTCTCAACATCAACGGATCCGTTCTACCAGCCACACTCG
AAAGTACGGAGCTGTGTGCCGAACTTATGGATGGATCCACAGTTGTCTCTGAAGTTAATGTGCGTAGTCCCTTCAAGCCAGAAGAAGAGGAAGAGCCTCG
TTCCGAGTCCAGTTCTTCAACAAGCAGCTCGAGCGGAACGCCACCAGCAACACCTCCCAAACCTGAAGAGAAGATCAAGAAAGCGCCGATCAAGCGCGTA
TATCTGGAGAACCAGAACGTGGAAGCTTTCCAGCCTGCAGTGCAAGCCATCGAGGACGCCGACATCATCATCCTCAGTCCTGGTGGTTTCTACACTTCGA
TTATCTCTACGCTGCTGGTTCCAGGCATCCGTGACGCCATCGCACGGAGTGCCGGTGCAACCGTGTACGTGAGCAACGTGACCACGCAAAACGGTCAAAC
TGATGGCTACACGTTGGAGAAAACGCTCGACGTTCTCTCCACTTATCTCGGTGCGAATGCCATCGACTATGTGATCGCGAACAACACTCAGCCACCAGAA
GACGTACTTGCGCCTTATGTAGAGCGTGGAGAAGAACTGTTGTTGCCTACCCATGACATGGCAGCTAGTAAACATCCCGTGTTGCTCCAAGGACAAACGT
TCCAGGAAGATCTAGTAGCTGGACATGTGACGCGCGAGTGGAAGAAAGCACCGATGCTCAAGCACAGCGGTCGTCGCGTAGCTGCAATTCTCTACACCAT
CATTGACAAGGAGATGGCACGCTACCGGCAACAACATGAACCACAGTCTGTAACCCCAAGTACATGTAGTGCTGCAAAGCCGAAGAAGTTATGGAAGTCA
GCGTTTACAGCACCCGCCGCGGTCTTTGGATTGCTAGCAGCCACAACGCTACTGGCATCTGTGTTTCGTCGTTAAGGAATACTGAGGTACACAAGATGAC
GGTAAATATCAAGTTTGTTTCGCTCACGTCACTTACATAGAAGTTCTACGCTCCCTTTTCTCCCCCTGGAAGCACAACACTACGAGTCATATTTTCACAC
ATACGTTTTGAAGCACACAGGGCTTACTTTCGCGGCAGAGATGATACAGAAGATGACGTAGAAGTCGTAGAAGACCTCGAAGGTCCCCCGGTGCACGTCT
GACCTGGCTGTTCCTCAAAGCCATGATGTGTCACTGCATATTCCGAGAAAGCTTGTGTGGCGATAAACAGCGTTCGGAACTCACGCATCTCGGGCGTGGA
GGCTGCAAGATAGCTGGCTTCGTCGAAGAAGACGGTGCGTTTACGAGCAAACTCGTCTGTCCACACGTAGCGGTGATAGCCAAAGTCGCCGATAAGTTTG
TTGACAGCTCGGAGGAATAATCCGCGAACTGCTACCTCGGGAAAGACTAAAGGTTTGCTCGGGAAGTGGTGAGCAAATACATGATCGCTACGACTCACGT
TCGGCTTGAGACATTCGTACAATGCGTCGCGTAGATCAAACCGTACACTGTCCGGAAGAGCACACGGTACCTCTCCACGTAACACAGCCCCCTTATCCAA
GTCCACGACCAACAATTCCTCTCCAGCTCCAGCGAAAAGATCGTCGCCCCCTTCCTCAACAAGTTGACGTTGGGCGTCGTCAAGCGCTTGCTTCTCAGCA
CCGAAGATAAAAGGCGTCGGACACTCCAGATACTGTAGCATTCGTCGAGGAAGCACAGGTAGGTACACATGCGGCCACGACAGCGGGTGCATAAGAGCAC
GTAGTGACTCAGCAACTTTCATGAGCACTGACAGATACGACGATACCAACAGGATGCGGTTCTCCAGTAATGCTGCCGTAAACACTAGCAGAACTGTTGA
GATGTCCAATGTGTCGAACAACAGACGCACAGAGTGATCCAGTCGTGGAAGCGCTGCAAGTAACGAAACTGATGTAGCTTTAGGAGTCAAGCCTCTTGCT
TCAAGCAGCGGTGAGTCAGGAAGCGGTGACGGCTGGTGATACTGCGAGATGTGTTCCTTTGACACAGATCGAGTCAACGTGGCAAGCACCTTCTTGTCAA
GCTTGAAACCTTCCCCACCGTAATTAAAAACCTCTTTGCTGTCGCTATTAGCAGCAGCAGTAGCAGCAATTGTCTCCAGCTCTAGAATAAACTCGTACGC
TTCTGCAAGACGCTCTCGAAGCAGATCCACCATCGGAAACTTTGACAGCACGCACACTCCATACGGTATCCATCGACATCCACTCGTTGAGTTTATCCGG
GAGCTTTCAAGCGCACGTCGCGATAATGGCGGTGCTGGCTTATAGAGAACCACACAAGCTGCAAATAATTCGGCAGCTGAAGCACCAGCACTACTGTCGC
CCATGCGAAAGTTAAACGCCAGCGGTGCTGGACAAGACGGAGCTGTAAGTACCACATGTCTGGGGTCTGCACTCCACGGAACAAGAAAATTTTCCACAGA
CTTGTCCACGACATGAGGTGTCGGGTCATGCGGCAATGGGTGCTGTACTACCTGCAGCTCAATTGAGTCTTCGAACACCCCAATGCCAGAATCATCAGTA
TCATGCTCTGCTTCTTCCGCTGTCATGGACACAGCTACAGCTTCAAAGGTGAGTACACCAGAGATGGCTTCAAAGCTTCGTGCAGTGCGTAGCGAGTCCA
GCGTCTTCTTCTTTGGCGCTGAGGCTTCATCGCGAGTACTGGATGACAAAACCGACATCGATCCGTTAGATGACGAAGAACTCGAACTACCACCAGCCCA
ATGATGTGCGCGCAATCCGTAGCTTAAAAGTAACGCTGACAGCCGCATAGAATCGTCGATAGAGTCCTTCTCGTCTTCAGGTGACAGCTTCGGGTACAAT
GCAAACTCAGCGTAAGCACGACTCGTAAGAAAGCGATGATACAGCTCCAGATGAATGAGGCTGAACTTGGTCAATATTGCGTCTTGTTCTGCTTGCAATC
TAGCACAGGACGTCACCAGTGTGCGCGATAACGTCTGCATCTCAGCGTCCCCCGCGTAATATTTCTGTGAAATGTACTTGAGCAATCTTCTGCAGCGATA
CGCAGCCTGCTCTATGCGTTCACGACGCTGGTTACTGGTGCTGCTCGATAACGCGCTTCTGGAGCTGCCACTAGACTTGAGCAGCGACATGTAAATGCGG
AAGGCTGGCTTGAACTCATACTCGACATCCAACCACAACGCAATCTCACGATGGTAGTTATGTGGGAACAGGAATATCCAAAAGAAATTAGCGAAGCGGT
GGTTCATCAGGATATCCTCGAGGCAGATGACTTCACGCTCCACTGTCTTCTGCATCTCCGTATAGAGGTCCGTCTTGCGAAATTCAGGAAACTTAAACAT
CAGCACCCGTTTAACTTTAACAGCCACGTCGTCAAAAGTGCGTAGCGCATCTTCACCTCCCGCTGCGAGGTCCCGCTTGATGGACCGTAGTTTATTCGAG
TCCACGATGGGAGGCTCGTCACTCCCACCGTCTGCATCGATCGAGCCGTTTATCAGGAACTGCGCGTTCTTCGCCAAGTATTTCATCGCAATTTTGACGC
CGTATGTGCGTAGCATGAGCACGTCATCCTTCGCGAAAGGTTTCTTCTGGTAGTTTGCACGCAACGTGCACCAAAACTGCCGGTACTCTTCAAACGAGCA
CAGGAAGAATAATTTACTCTGGTCTGCAGGATCAGGTAGCCACGCCGCGTAGTAGCGCATCATCCGTGGGTTACTGATAACTTCCTCAATAGAAATCAGC
GTGGTCGGGTCTGGTATGGGTTGGTGCGCTGGGAACGCGAATTGCTGCTGTTGTCGCTGTAATACTTCGTCCTTAAAGGCGCGCTGCATGACTTTGCCGA
TATTGTGTTGATACTGATCATGCATCCAGCGATTCCACTTCTGAAACTTGGCTCCACCATTGGAATTCTGGCCAAAAGATGGCAATGGGGGAAGTATTGA
GTGATGCTGTGTTGACGATGAAGAAACAGCTGATGAGGCGCCCGACAAGGCTCCAAAGCCACTGCCACTGCTCATCTGTGCGAGAATCTGCTTCTGTTTG
TTCGCCCAAATCTCTGCTGACGTCGGCGCTGTTGAGTTCACCGTACCATGGCAAGCAGAAGACCCATTCTTGTTGCCTGCAACTGTAGAGTACAGAAAGC
TTCGAGCCTTGAGTTTGACGTGCTGTGCCCACCGAGACTTGGCGTTTTCCAGCTTGACATCCTCCTCTTCCTCCTTTATGCTGGTGACTTCGTAACTATT
GACGTCTTCGTCCGATCCACTCAGCACTTCCGACAGTTCCCTTGCACTCAGCTCCCGTTCTGGCTCAAATAGGTCCGTCTCATACAGCATCTGCTCTGAT
ATCGTGCTCCTCCTGAACGTGCTTCGACTGGAAAACGAAAAGGCCAAACTATCTCGCGAATGCCTCGACATGGCCAACGAGTCTCGTTCGCTCACCGTAC
CAGCCATCACGGCATTGGAGCGGCGTTGGTGCGGCAATAAAAAATCGTCCTTGTCTGTATACAGCGACGAGCTCAATGCACTTGCCATACTCTCTCGAAT
CACCTCCTCGGCTGATATCGTACTATCCGGTGGCAATGGTGGACTCGAATCCAACGACGCTATAATGTAACAGCAAAATAACACACACAAAAATTAGTCT
GCAATGCCTACTACTCTCCATCACTTCACGTACATGCTCTTCTGTATCTCTCAGAGCCACTGCTCCCACTGTATGAGTCTCCCAGCATGTTCCTAGTGAG
TCGTCCACCGTCCGACATGGCATCTTCATCATCAAAGCTCATTGCTCGAGTGTGAGCGTCCATTGACTGCCTAGCTGAGTCGATATCCATCATCAAAAAG
CTAGCGTGGCTGCGTAGAGCAGAAGAAGAGACTGGGACGCCTGCACCGGCGCGGAAACTCGAGCCTGCGCTGTTTAGACGGAAGGAGGAGCTGAGACCTC
CGCTCTGGCTGAATGGATTAAATCCTGAGCGACTAAGTCGTAGTCCAGATCCCACCACGTGGTCTGCAGATGCACTACGTCGGAGTTCCATGACGTCACT
GGGCAGTAGTGTCCGCTCTGGGTTGTTGACACTGGCATAAGAGGTTGGTGCGGATTCAGCGGAGGGTGCTGGAATGGGCGTGTTCAGGACAGCTCCACTA
CTTCGACTACGCCGCCGAGGGCGCGTGCGGACGTTGGCGCGCTCAAAGTCATCGCTCATGACAGAACAGGGCGTGAGCGCTGCGCCGATCACTGACCGCA
CTCGAGCTCGGCTTTGGGATGTGTCTTCCTGCAACAAAGTCGCACTTAACACAGGAGTTTTGGTAAGAAACATAAATAAGGTGGAGTACACCACTTGGTG
TGGTGTATTGGTGTGATGTACATTTTGAGATTCTGATTCCTATTCTCCCAGTTGGACAGATCGCTTGGGCGTTTGAGCAGCTATGACCGAGCGTCGAGTG
AACGCCGCGCAGGACGCGGTCATTAAGGTGCTGGTATTGGGTGATGCCGCAACAGGAAAGACGAGCATCATCAAGCGGTGCGTAGATTATCCTCTTGTTT
TTTTTTGGCACACGAGATTGACTGCTTTTAATGCAGATATGTACATGACGCCTTCTCGGAGCACCATCGCACTACGATCGGCGTGGACTTTGCACTTAAG
GCAGTCACGGTCAGCGGTACGACAGTGCGTCTGCAGCTGTGGGACATCGCCGGACAGGAGCACTTTCGCGCGCTCAACCGAGTGTACTACAAGGATGCAC
TAGGAGCACTGCTGGTCTACGATATGTCGCGTCCAGAGACGTTTGACAGCATCATGAAGGTAGAGACAGGGGGTTATGCGTGTTGATGTGAAACTTGTGT
GCTTACACACTGCGATGTAGTGGAAGAAGGAGATTGACTCCAAGGTGGAGCTGCCGAATGGAAAGCCGCTGCCGGTTATTTTGTGTGGCAACAAGGTGAA
GTTTCGCTAGTTATAACGCTTGAACATGGAGATACTGACAAGAATCCTGTCATTGTAGTGCGACTTGAAAGAAGATGTGGATCGGGACTTCTTGGACGAG
TTCTGCAATACGAACAACTTCACGGGCTGGTTCGACACATCCGCCAAGGAGAACATTCACATTGACGATGCCGCCAAGGCGTTGGTGACGGGCATTCTGG
AGCACAAGGACATTTTCAAGCGGAAGTCCGAGGCCAAGAAACGCAACGACACTTTCCGCCCCACGAGTGCTGCCAACAGTGGCAACGCAAACCAATCCAG
TTGGTGCTGCAACAGCTTCTAATCTCTCTATTCCGACCAGCACAAGACGTTGTTTTTCATGTCATGTCGATGCATAGCATGCGTTGGACGGGGACGACGC
TAATCTTTTTAAAAAGTTCCTAGTACCACTTCGTCTGCGGTAGTTTTGACATTAGCTACTAGACGCTGCGTTCGAGTCTGCGAGACGCCGCTTTTTGTTG
CTTCCTGAGCCTTCAGAACGTTGTGTCTTGGTGAAATGCACGGGGAGTCGACGACTGTTTGAGGCAGAAATGCCACGATTCTCCATGCTTCTTCGCACCT
GTCGGAGTTCATTCCGTCGAGCTCCTAGTTTCTCCAGCAGCTCTTGCTTGTTGGCCTCTGCTTGATCTAATTCATCCTCCAGTTGGATCATCTCCTGCTC
GCGTTCATCCGGACGATGGCTCGTGAAAGACGCCGTGATTTCGTTAATGATCTTTTGAACTTTCGCTTCAGCCTCTGGTTGCTCCGCCTCCATGAAGTCG
ACGGCGCGGATCAAACGTCGTTCTTCCATTCTCAAGCAGTACTCACAAGATTCGTTCTCGTCACGGGCTTTACATTCAGACAAATGTGCAAAATGGTGCT
CCACAGCTCCGCACATAGGCTTGCTGCACACCTGTAGATCCAGATGATGCTGTAAATGATCAAGAATGGACTTGCAGTTCAGCAAACATCGCTGGGCTTT
GGAAGGAGCACAAAATGACGCGTCCACAATAGCATAACCCAGCTCCATAACTCCAGCAAACTCTCGTTGTGCCATCTCTCTGTTGTCTCCTTCTGCCTTG
GCTCGCAAAAGTTGATTAATGAAATCCGCGTTGAAGTTGGCGGTGCCAGGAATGCTGTCTTCTAATGCATCCTGCGACTGCTGCGCGTTCTCCACAACTA
AAACGTTGAAAACATATATGCGTTGGTGTTAGTTTATGAAAATCACTTGAAAGTGTTTGCCAATTACCTGGAATAATGCTGTTACCATCGTCTTGAGTCT
CAGATAGTTGCTCAGCCACTTGACCTCCCGTTGATGACTCTGAAGGTGTAGTGCATTCGCTTGTTGGCTCTCGCTTGATAAACACGTTGTCACTTAAGTG
CCACCTGTACTTAGGAAAATTAAAGATCGGAGCGCTGCTTTCTCTGGCCAGTCGATTTAGTCGGTCGCTTTCTGCACGGAGAGGCTGCTTGCGTTCGGTC
CACCTGTTGATACTTTGCAAGCAGAAATTGCGAGTTGCTTCGTTGTGTGCGCCTTGAAGCGCTCGACGTTGGTCGTTAATAAGATGATCGAACGCAGCAC
AAACGCCGAGAGTCCGTCTTTGCCGGATACGAATACAAAACGGACACACAACCTTTTCGCCATCAGTCGAAGACTTCGCAGAACACGTACTTAGGTGTCG
GTAGATGACGGAAATCTCTGTGCACTTGGGGTCGCGACATACTTCGTCACTCTTGCAATGTTCATAATGTAGAAGTACAGAGCGACACGTTGGCTCTTCA
CATTTTCCAATCCGCGCGCATATGAGTGCATCCTCGACGACAAGAGCAGCTTCGATTCGAGTAGCCAACATCTCCATTAGTACGTGGTCAGTTGTAGGGA
ACCAGCGCAGCAGCTTTTCCAAATCCACAGGTTTGGGCTGGAGTGTAGACTTCGATCGCGACTGCACAGTAGAAACAGCAGTAGTAGCAGTAGGCTGATT
AGCTGGAGCTGGTGGCACTGAAACAGATACAGTAGGGGCGTCAGTTGGGGCAGCAAGAGATGCCGCAGAAGACGCTGGTGAGGCTTCTGTAGGAGCAGGG
TTTGTCGAGTTAGTCACCGAAGTAGAGTGTGTAGCTGTTGATGCTTGGGATGACGCCAGCGACTTCTTTTTCTCTTCGTCGGCATTCGATTCAGGTAGTT
CTTCAACTCTTGGAGCCTTACTTCCCAATGTTGAAACTAATAGCGATGCAGAATTTGCCGTTGTTGCTGATGTGTCTTGCGCAGATAAATCTTTTGCCTC
TTCCACTTCGCCGTCCTGTTCAACACTCATCGCGTCTGCGTCTTCGCCACTGCTCACTGACTCGCCGACCACTTCAAATTCATAGCCATCTTCCACTAGC
TCAGCATCTTCCTCTCCACCATCTTTCTTCGATTCCTCCTGCACCTTTTCTTCGTTAGCTGTAGCTAGACTCTTCGTCTCCGTCTTGTCTTCCGTTCTCG
CTGTTGGTTTCGTATCTACTACGACATTAACCGCCACTTCTCGAGCTCGATCTCCATTAGAAACAACACTGGATGCATCCCTAGCAGGTCTTGCCTCCGC
TGCAGTATTTATGATGCTATTGGCTACGCCGTTCGGAGTAGACCCCCAATCGAGGAATGAGCGGGTCTCTCCGTAGCTGCTCGTGAGCTGGTGGCTGCGC
GCGAAACCACGCGAGTGCCACAAGCGGGAGCAGTTAAAGCAAAGCGCCTTCTCTTTGCGCGGGTCGCACGCTGAACACTTGTACAGCCAGGGCTCAATGC
GACACCAGCTGCAGACGGTGTCCGCCATTTTGTTATGCGCCAGTAAAAATAATATTTACCACAAATTTTCGTTTAAAACAATGTCACAATGGCGAATGCG
AAGCCTTACTACGAGTCGGTGGAGATTACTTGTAATCCTTCGCTGTAACATGTACTTTGAAGCATCAACTATGATAGCTTAGCAGCAGGTCATCAAGATG
AGTCATTGGATAAATGATTTTGGGTTGAAATTACGCGGCAGCAACCAAACAGCAAAAGATATCAAGTCCTGCAATAACGTCCACCTAGAGAGGAGAAACA
TTCACAACACACCGGAAAACAAGCACCACAATGGCCCGACTCAGCACGAAAAACAAACCAAACTTGAGATTTTGCTTGCACTTTCCTGCTTTTTTTACCA
GCTATCCTCGTTCTTCACGTCCTCTCTCGCAACGCAGCAGCTAATTTCAGTTAGGAAAAGCATCCCACTGCGTGTAGTAGCTCGGCTGCCTCCACGTGGA
CAGGTCGAAGATCTCCTACTCCTAGTGTGCTCTAAGTGGCGTACTTGGCCGTCCATTCGCGAGCAGTGGCATCGTGGCGCGCGCGGTCTGTTCTATAAAT
TTGCGCGATTTCGGGCACGAGCGGGTCATCTGGGTTGGCGTCCGTGAGCAGTGAGCAGATCGACAGCAGCACCTTCGAGATAGTCAACGCAGGGCTCCAC
TGATCTTTTAAGATATCCAGGCAGATGCCGCCGTTGGCATTGATGTTGCAGTGGTAAATGCGGGTCGTGAAGTTCACCTTGGGCGGCTTGAAAGGGTAGT
CGGCCGGGAAGTAGATGTTCAGGAAGTACACGCCACCAGCGTACGGGCTGTCCTCGGGGCCCATGATGGTCGCCTGCCAGTGGAACAGGTCGTCGCCCAC
GGGGCCGGCACTGCAGTTGGCGGGCGGGTCACGACCCAGATCCTGCAGCTCCTTGTTGATCCGCTTTAAAGCCATGTTCACTTCTGTGCCTTCTCCTCTC
TGCTTCGACTCCGCTCCGCTGCTTCCGAAAGGAAAATGACAGCGGCAAAGGGGGAGCGAGGGGGGGGAAAGCTCGCGTGATCCCCTCTATCGCGCAACTC
CTTAAAAACAAAATTGGTTGTTGAAAAGACAGTTGCGCAATTAGGGTCTTCTGGAAGTTTTTCTTCGGTTGCGGAGAACAGGCTCATGGGTCGCACTTAA
ACGGGACTCGCCCAATGTCAAACCCATGACTTACAATTGGCCAAAACGGAAGAAACACAGTGAGTCGATTGGTGGAACAGGGACGCCCCGGGTCATCTTC
GTGAACGCGCAAGCGTGTATTGTCACCGAGCCAAGGCGCCACTAGAAGTGGAAATTGTGGCAGCTATATGCATCACTTTAACTGGAGTCCAGCTTCGTTC
GGTCTTGGCTCCCGCCAACTAATACCAGCGGCTACGTGGCAGCCTTTCACAATAAAATGTGTCGCCGCCGTCGTCTGGCCACTGGCCAGACGACGGCGGC
AACAATTTTTATTGGCCAGTGGCCAGATATCTTTTGGCGATGGCACGACGGCGGAGGACGGAAAGAGACGGGAGCGTTTGTCGCCTGCTTGCTCGTCAAC
CGCGCGAAGCCTTGCACGCTGGCCTGGCGCAACATTCAGATAATGTCAACATGACCCGCCAACTGTCCCGCTTCAACGTGATCCCGTCGACGTTAATGAT
GGTGCTCATCACGGTGGTGACCACCTGCCGCGGCGGCTTCCATGCTACTAATGAAAGTTGTACAAACAGGCATATCGTAGTCAAGCGGACCCAGTCGACT
GTCGACTCGACAAGGTACTGTAGAGCTCCATCCTTGTCGTGCATTTGAGCTGCAATTGCACCGCCAATGCGTCTACCGGTATTTGTACAAAAGGTTACAA
TACGCTGATCTGCTCAGTAAATATTAGTAGTATTAATACATTACCTACCACAATGCTGAAGTAGCCTACACCCATGCCCACAATGTCGATATTTTCATCT
CCAAGCAGCGACTTTACCAGCAAGCCGTGAGTAGCATCAGTATAAGCAGGTTTGATCATGATGCTGATTGTTTCTATGTGCATACATTTACTGCTCCAAT
TTACTTTGTACAATGATACCTCCCATACAGCATCTTCTCAGTATCCACTTTCAAAGGTGTGGCACCACCCCGATGCTTTGTAAACTGGCTGGATTGTGGC
CGAATCGGCGGCTGTCCGTGTCACTCTTGCTCTTGCGCTTGCGACGCTATAGCGGTAGTGCTCGGCCCGACCACCTTCTACTGTCCATCGCATTTTAGCA
TCCATGGGTGACCGGTACCGCAGTGCTCAGTCTCCGCGCAACAGCGGCGGAGGCGTGTCGGATGAGCGTTTCGGCAAGCTCGTCACGGAGACGAGCAAGG
GCATCTCGACCTTCAACCAGCTCACGCGCAGCATTGCGCAAAAGATGTCGCTGTTCGGAACGCCGCAGGACTCACGTTCCAACCACGTGCAGATTAAGGA
TCTGACCGAAAAGGGTAACAAGCTCGTGGCCAAGATTAACCGCCGTCTACAGGAGCTAAGCCGGGGAGCCAAGGGTGCTGCTGGTCGTACACGACGTACT
CAGGTCAACAAGCTCTCAGCAGACTTTAAAAACCAGGTGCGCGTGTTCGAAGAGACGTGCGAGCGTTTGCTCGAGTCGGAGCGACAGTCGGTTGAGTTTA
TTCGCCGCTCGTCGCAGAGCTTTAAGGGTAACGACGCCCGCCAGACGCGCGGCGGTGCCGAGTTCACGAACTACAGTGAGGACCAGATCTACGCTCAGGC
TAATGTGATCGTCTACGATGAGGATGGTATGGTGGCGTTAAAAACTATTTATTTTATTTGAAGAGAAGAAGGCTGACTAATCTGGAATGTAGATATGCAG
CGGAGAGAGGAGGATATTATCCAGATCAACCACCAGCTACGTGAGGTGAACGCTGCATTCCAGGAGATCGATGGTCTTGTGCAAGATCAGGGAGAAATGG
TGGTGGAGATTGTGGATAACACCGAAACGGCGAAGGACAACGTGGAGAAGGCTCTGGAGCAGGTGAAGCAGGCCGATGAGCGCAGAAACTGCTGCGCATG
CTCCAAGATGAAGCTCATCTGCATTGCCATGCTCGCTCTGCTCGTCTTCATCGCCCTTATGGGCATCATTTTCGCTTCTAAGTGATCAACTGCAACGGGA
TGTAGGAAAATTGTCATTTTGGCTATCTTGGTTTCGTCTCGTGAATACTGTCAAACCATGAAGGTGACAGCCATCCCCAGCACGAAGTCACAAAGCAGCA
GTGAAGGTCGTTTATTTCTAATAGTAAGTGGGTTGTATAACTTCGTTCTATTGTGATTTTTACAATTGACCTTGAAAACTACGAATAAATTCCTCAACAC
TATTGTTCTTCAAGCTGGAGACGCGCTCCAATTTCAGTGATCATGTGCGAGCCCCGGCGACTATTAAGGTTCCGTTTTGACTTTGAAGATTGGAGGATGC
TACCGGCCATTGACTTGAGCACGTTTCCGACCGATCCACTGCTGTTCCGTCGTCGTCGTATAGCTGCTTCCGAAGGTACGGTTGCATCTTCAGTAGCGTG
TTGGCGTGCAAGGCGTCGTGCTCGTGATGCCGCCTCTGATGACGAGCTACCACCGCTGCCTACTAGTCTAGTACTAGAGCTTCTTCTTTTGAGATGTGGC
CTGGAATCGACAGAAAACATGGCCGAGAAAGGTACAGCAGTATCTCGCTCAGACGAGTCGAAGCACACTGCACAGACGCGCTCCTTCTCGTTCACAGCTT
CGACGATACCATTGAAATATCGTGTAGTACCGTGCACACGGCCCATAACGGCCTCTCCGACGATGAAAATCACAGGTGACAACTCAAAACCCATCGTATC
AATGCTGTAGTTCGTAAGCCTCTGAGAATGGGACAGCGCTGTAGTATCATCCAAACGGGTGATCTTGTCGGGGGGGATATGTGCTTTCTGCTCGCCAAAG
TCGAACACCAACGTGTACATGTACGTCGAGTTCGAATTTACCGGCGACTCGACACCAGATTCTGCATTAATGGGGTCTTGAGAAGTCCTGGCAACGATCT
TAGCCGAGCAATATCGTGCAAAACGCGAGCTCCACGCAAGCACGTAGTCTTCCACCGCATAAATCGGCGCCTTATGCGCTCGATTCGAGTTCTCACTGGT
GACTACAGTGGTAGTTTTTGTTTGTCTCCGCTGATGCTCCACACTGTCAATAATCATTTGTGACGGGAACACCTCGAAGGCAATAGTACCGTCGGAAAAA
CGGAGGTCACACGCCGAAGAAGCGTGCGTTTTGATCACGATACAGCTCTCCACAGTGGCTTTACTCGGATGATCCGCTTTAACCTGATATCCTTCCTCCA
GCACTGGCAACGACGCTTTTCCTCCACCATGGGCAGCAGCCGAAGCTTGCATTAATACAGCATTCTTTAGAGATCTCACGTCTTGATCTGCAGGCACACT
TAAGCGCTTGCGTTTACTGATAAGATGCGGAGGGATCTCGTAACCAGTAGACCCGTCAGCGAAGTCTACAGCTGCCGTTTTGTTCGAGTAAACTCCATTC
AGATGTCCAAGTTTCTCTTCCTCGCTTGTGCTGTCGAGATCACCATTTCCAGCCGAACATTTCACGTAGATCTGATCACCAATGTACACTTTGACCTTGC
CACTACAAACGAGAAATTGGTCTTCCGTGATGGTAACTGCAGCTTTCTTCTTCTCTCGTAGAGGACTGATCATGTCTGCAGGAACATTCACGAGTCGAAT
TCGGTTGGCCAGCAAAATATGGAAACGAGATTGATGCTCTCGTTCCAAAGTAATGAGTCCATGGCCGGAAAAGCGACTACCCGGATATAACGAAACCTGA
ACCTTTTGACCAACAAAGAGCACGCGTTGTGATCGCTCGAGGTCCGTTAGCTGCTGCTCTAGTTCATCCACCGATGGCAAGAAGTCCACTTTGTCATGTG
CCACCACCTGTGCGGTAATACCGTCTTCATCTTCCGTCATGACGGCGTAGCCGTCACCGACTCGTTCTTTGACTGTACCGTACGCGCGAATACTATCAGG
AGCTCGTTCGTATACAACTCGAAGGCTACACTCCACAAGTGATGCGGTCGGCGAACCTGAATTGCATCGGTTCAATCGTATAGAATGGAGCTTTGCTTCC
ATCAATCGGATATGTTCGGCCATCAAGAGTTCATCTGTGAGTTTGGTAGGCTGCACCTTTTTGTTGCCACGCATGAAATACTCGGAGATAATCTGCTTGA
GACTTCTTGGCGCTGGTTTCTGGCCCTTGTGTGTTACCGATAGTCTATCGATCTGAGAGACCGATGAAACACTTGATCGTCGTCGTTGGGGTCGCGTAGC
TTTGCCCATACCGAACGTTTGTGTCATTTGCTGCCACGGTGTCATCGTCATGTCTTCGTCGCTAGAATCATCCGAGTCACTAACTTGCGTCGAGTCGTCT
TCGTAGGCCACTCCACACTCAAGTCGCTTCATAGTCAGAGCTTCGTCTTCAAGAAGAAGGCGCCAAGTCTCGTTCACGGTACTAATAACACTGCAAGAAG
GCAACCCGATCTCGTAAGCGATACCACTATCGTCAAAGCCCAGTACCATTTCTCTGGGTGGTGTAACGGAGAAGTCCACCATTACATGTTGTAAGGGCGG
TAGATACATCTCTGGTGCTTCCGACGGATCAGGGTAATAATCTTCTTTCTCTTCATCTTGCTTTTGCCTGGATTGTCTCCTTGACCTTGTGCTTTTAAGA
CTCTCTTCTCCGAGGCTCGTCGATTCACTATCTCTCCTCTTACCCTGATCTTGACTGTCACGGCGCATTATCGACGGTGACGCTAATGAAGGGTGCTCCC
GCAGCATAATATCCTCGCGCCGAACACGATAATCGAGCGTTCCGTCGTCGAAAACGAGCATAAACATCCCAGAGCCGAGATATGTGGCGAGGTTACCTGA
GTAGAAGTACGGTGTCTTCTTGTACCGTCCAAAAACACGCTGACCGTACGTCCACTGGCTGTGCAATGGCACAAAACGCGCTGTCGTTGGTATGTCAGGA
GTATTAGAGCTATGCTCGCTGATGTTATCAGATTGCGGGGTCTCCTGATATTGATGAGTGATAGACTCTTGATCGTTCGCTTCTGAGGCTATTGACACAG
CCTCTATTGCCTTGATACCGGCTGAATTCCTCTTCGAAGTGACGGTACCATCGCGATGAATCTGTAAGCGTTCACTCGGCTGTCGAATTACCAAAGTCGG
TCTGTTAGCAAGCGCCCCGTTATCGTGAAGTTTAATGCGTTCGCTAAGCTGTCGAATGGGCGAAAGCGGAACTTTTCGAATTGGTTGCTCGGGCTTATTG
GCGGGTACATCGATGCTCTGCGGGATACTTTTCGTTGGTTGTTCCAGCGTCTTGACAGATAAATTGTCGCATTCACGGGCATAAGCATTCGTATCTTGGA
GTGGAGATGCTGGTCGACGTGGAGATGCTGGCCGACGTGGTGATACAGGCGAGATCTCTTGAGTGGTAGCTGTTCGATTATCATGAACTTGAAGTCGACC
AGCGAGCTGTGTAGTTGATGAATGTCGACTATCGTTTCCAGAGAATGGAGAATAGTGTTCTTCGAGGTCTGACGTGGCTCACCTGCTTAGTCTACCTGGA
TGATATCGTAATCTACACTCGCGGTGGGATCGAACGGCATGTGTTGGAAGTCATTATCGAGAGCTCATCTGTCATCGTTGCCATTCCTCCTATGTCAAGC
ACCGGGAAGCGCCCACTGAGTCGAGGTATCGACGGTCTCGATGCTGTGGCTCTTGGCGAAGCATCTCGAGGTTCAATTGAACCAGTCGATACTAGATCAT
CGTGAATAAAAAGGTGGCCGGTGGACATCAACGCAGATGGCGGTCTGTTCGATGTCGACTTTGGGGCTTCGCCTTGAGCACCTTCGTCGTGGATAGAAAA
GCGGCCGCTGGGACGTCTCGAAGGCGGAAGCCTGGCCCTGGAGTCGACCGCTGAAGCTCCACGCATCTCATTAATTGGCTTGCTAGACACTGAA