Description :
From Genome Similarity Track
Location :
Scaffold_4:265527- 268268
Sequence
2741 bases(100 bases per row)
GCGACTCGGGCTCAGGTAGGCTCAGCACCACAAGGTAGGTGTGCTCATACAAGAGTAGTTTGCTCTAGTCCACGTCCAGCCTCATGCTCGTGGATACATG
CACACCTAGTGAGCTTGTCCTGCAGGTCGAGCGGAAGCGAGCCAAAGCTGCAGCAGCACCTGCACGAACACCTGCACGAAGTGCTATGTACGCTTTCCCT
CACATACAGCAACTGAAACGTGATGGGGCACGACGATCACCTTCTTGTGGGGCTGCCGCAGCCGCTTGGTGGCTATTGGCCACGTGTCGGCGCTCGTGAT
GTAGAGGACGGTCCCGCTAGCAAAGCAAAATGAGGTAGGTTAGATTCATCACCACGGCTACGAAGAGAGAGCCGAAAAGAGTATGCATGCACAGCAACTC
ACCTTCCATAACGGACGTCGTACGCGTCGCGGGGTCGACTGGTTCTGGAAGAGTTGATGAGAAAACGCGAATGTTGAGCCAATAGGAACACAGCAATTAG
GTCATGACCTGATTTTGATATTTGCCAGGTAACACGGGGTTAATGTGGTGATACCTACGAATACCATGTGTCTAGGTCATGACCTAGTCGTGACTTGGCC
GCTGATACTTTGATATAGTACATCATAGCTCGTTAGTGCGTCACATCAAAGAGTTATTCCACTACGTACCAAATGCCTTATCGCATGCTGGTTCAGCCAC
ATGATCATGTTTGCCTAGATTAAATCGTATGTACAGTATGTCCCAACGCGGCGAAGTAGTCACGTAGGCTTTTGTACCTACCGGGACGAGTTTCTGTGTT
CAACAAGTACGTGTGGGCACGTAAAACGTACTAAAGTTGCCTAGTTCGGTTCTTGTTTAATAAGTTCAGCATTTCGAGGGTCAGGGAACCTCTGGTAATA
GCAGGTAACTCTAGCAACTAGCAGCGGTGCGCAGTATCAGCCGACTAAATCGCAACAAACTCCAATTCAAAGACAAATCTAGCAACTAAGTCGACCGCTT
GAGTTATTGTGCGTTTGGATTCAAGTTAGCTCGAGCGGATTCAGGTTAACTCGAGTACTCGAGTTATTGTGAATCTTTTCCTGTGGATTCAACATAACTC
GAGCGCTCGAGTTGTTGTGAATCTGGTCAAGTTAATATGAATCCACTCGAGCTAAATTGAATCCCGATGCACTCGAAAGTGACTATCAAGCAGTTGGTTT
AATCTGCGTTCTAAATGCAAGTTTACTTTGCAGAACAACTTACGCTGCATTGAATGCGTGTAGACAAGGGGTGTTGCTTGAGGCTGGGAGGACAAAGGTG
GAGTAATGGGAGATAATGAATTATTGTACTCATTCCTTCTGTTCCAGTAGCCGTTCTCGCCAAACTCATTAACCACTTGACTGTGTAGATGTTGGGTCGA
GCAAATATAAAAAAAATCTGACGTTATGGAAATCCTTCATTTGCAATTCGCCCACGAGGTTTAGCCAAATGAAATTCAAGTTATCGTAAGTTTAAAAATC
GTGAATCCTACTGGACTCGATGTAGTTTGGCTACTACGAGACTCCCAACCAAGATCGATCAAGCCGACGTCGTTGCCATGAAGCCACGTGAACTCGAAAG
TGTAGTCCGTGCCTATCGAAACACAACGTATATACCGTTAGTTAAGCAACCAAACCTAAACCAATGATGGTGCAGTACGCCGTACCGAAGTGCTGGAGGG
AGATCTACTCACGCGTCATACGCGTGAGTGAGGAAGTCGCGATGGAGCGGGCGCGAGCTTCTCAAACGTGAGGTCACTCTCGAAGTTATCGAAGGGACAC
AGATGAAGTGCACCTTTGCCAGCAAAACGCGCGGAATGTGAATATGGAGACGCTGCGCCCCACTTCCTATTTCCTACGTTACCGACAGCTTACTAGCATT
ATAGTTTCAACCACATCAGTTTCAGACGCATATTTCCTCTTTCAGCTTCTTCTTCTTCCAGCTTCAGGGACCTCCACCAGAGCAGCTTCACGAACAGCGC
TTCTTCTTTGGACCGCCATTGGCATCTGGCGCCTTCTGCGATTCGTTTCCCCCGTGGCCATGCGCCACGCAGCTCATAGTCGTCGGGGGCAGTTGTGAAT
ACACGTACGGGCAGTCTGCAACTCCCATCCAGCAGGAATAGCAGGGTCAAGTACCACTTTAGTTGCCGAACTGATCCCAATGGCAACGTCGTCGTAAGTG
TTGACTTTCAACGGCTAGAACGTGAAGCTGTAGTAGGAAGTAGGAACGTCTGTAGTTGGAGCTGGCGTAGCATATTTGTAGCAAAGACAGCAAGCAAAAG
ATAAAGACAGCAATGCAGTCGCAGCATGCAATCTGTGTTGTCTGGTTTCTTAGAGTCTCCGGTCTCATTTACGTATGGATGGTGTGTCACAATGCTGATG
TCGTCGGAATGTTTTCTGTGGTACGAGCAACTTTTTTTGGACGAATTAATGTCTGTGAGGCTCTCCATGCAGCTCTTCTACACTCCACGACAAAAAGATA
TGGACACCACCAAAAGTGGCTGTAACTTCGTCAATTTTTATCGTTTTAAGGTGCGGTTTGGACTAGAGTTGCAGAACACGCTGATAAAGATCTGCACGTT
GCTAACACGCGCGCTTTTGCGCTTCTTCAGGTAGCTCACATACAAATCACTGGTTCTGCCCAGGTGACAAAACTTATGGACAGCTAATCCCCATACAAAA
TCCTATATTAACCAAAACCCCTTACAAATGATACGACTTGG