Description :
From Genome Similarity Track
Location :
scaffold_6:26550- 35314
Transcript NameFunction/comments
g382.t1 hypothetical protein PITG_04174
g383.t1 protein phosphatase 2C, putative

Sequence
8764 bases(100 bases per row)
AGGAAGCGGCTACGATCACGCCTGAGCTCAGGGCTCGGGTGCCGAGCATGCGAAGTGAAACGAAGGCCAAGTTCTTGTCCCGCCTCTCGCTGTGGACAAG
GTCAAACAACTCGCGTCCAAGTAACACCGAAAGCTTCGACATCACGGAAATAAAAGACGGCACAGAAGTATACGTGACGCGCGTAACCGGCGCCAAGCTG
TACGGGGACATGGCGCAAGGCAACGCCAGCCGCGTCGAGGCAGTGGTGGACGTAGAAGAGCTATTTTTGGGCAGCGCGGATACGCGTGAGGCTCTAGTTC
CCACAGAGCCTTCTGCAACTACGCATGTGCGTGCCCCCATGGATATTGATGGTGGAACTAATGCCACCGCAGCCAACGCTCTTAGTAACGACGACTGTAA
AGATCCAACGCCCTGTCCATCTTGCGACGATGCCGTCACAGCTGCGGATGGTTCCAACAGCGCCATTCTGGATGGTCCCAACGCCAATGATGGTCAAGTC
GGAGCCGCTTCTTCCAGTAACAGCGTCGGCACAAAATCGGACAGCTCTAGCAAAACGGATTGCCAGCTCAGCGATGGACAGCAGCCCGCCACCGAGATGG
TTTCCGTCACAGAATCCGGTGGGGTCGCAACATGTCATTCCAGTCGCCAAAGTAACGAGGCTGCGATGCTGTCGACGACGCTAAGGCTCCATTCCAGTCG
CCAAAGAAACGTGTGGCGCTGAAGGAGAAGGTGCCGTTCAAGAAGACCAAGAAGGCGTGAACACGTGACGTGTGTGGGTAGCAGTTTCTGCTACATCATG
GAGTGTACCTCGTCGTGCCTGTCTCAGGCACGAAACATGCATGTGAAAGCTCATTTCAATTTAGGAGGTTTGGTTTAACGTGCCATGTTATGGCACTGAT
TAATTGCATTTGAATCTTGGTTGTGGTTTTGGTAGCGTTTTGGACACTAAGCTGAACTGTTCGACGTAGTGCCCTAACTCTTGCAGTGGTAATACGCGTC
AATTTAACCACCATTGTGAAATCTCGCACGTAGACTTGAATCGACAGGGTTCCACACCAAAAAATGTTCAAACGGGAACTGCACCACAGTCTTTGGGTCA
TACATACAAATAGTGGTAAATCGACAGGGTTCCACACAAAAAAAATGTGCAAACAGTGAAGGTTATGGTTGATAATGTTACTCGAATGTCGTTTGGGGCC
GCCTGGGTCAACATTCACTAAATTTTAGAATTTCTGAGCAGGTTATAGTATATCGGAATCTGTATATACTATAGTTTGTATTACTCTTACAATTTATGAC
AACTCTATTCATAGGACAATAAATTCAGCAAGGGAATAGACCACCGTCAGATCCTGTCAAACTCTGGATATAAATATCCTCTTGAGGCTTCTCCAAGAAT
GTTGGTCGCACTTCAACTACGTCACTATTCTGTTTGAGTGACAATTGCTTCATTTCTTGAAACGGGGGGAGCAGAGCGCATCAAGAAGCAGGCAACAATC
ATGGCGTCAAGAAACCTCATCCGCCGCTCAGCGCGTCTAGTGGCCACCGCTACAAGCAAGCGCAGCGTGGTCTGCGGTGCCTCCACGTCGGCAACGGGTC
GCAAGCAATTCCAATCATCCTCTAGCGCAGGCCAGATCCGTCTGCAGAGCACCCAGAGCAATGCTGCCAGCGTGGAAGCGTCCAAAACGGAAGCGTCAGT
AGATACAGAGCGACTTATCCTTGACAAGGCAATGGACCACGTGGCAGTACACGGGTACGTTCTTTTACGATGGATTTCATTCTTCTATTTACTGATATAC
CTCGCTTTAATTAACGTATCACTGGCTGTTCACTCGTTAGATGGACCATTGAGGCTCTAGCTGCTGGCGCCACCGACCTCGGCTACCCGTCGGTGGCGCA
TGGAATGTTCTCGCGCGGGGCTGTGGAGCTGGTGGAGTATTTCATGGACTCCTGCCTCGCCAAGCTGCGCAAGACGCTAATTGCCAACACGGATAAGCTG
CAGGGCATGACGGTGGCTGAGCGACTCAAATTTGGTGTCCGCACGCGTCTGGAGATGATCGAACCCGTGATGGCTACGTGGCCGCAGGGTATGGCGGCTG
GAGCTCTACCGCAGAATGCTCCGAGCACTGCGAAAAGACTGGCAAAGCTGTCGGATGAGATCTGGTACTTTGCCGGTGACAAGTCCACGGACCTGTCCTG
GTACACCAAGCGCGCCATTCTGACGGGAATCTACGCCAGCACGGAGTTGTTCATGCTGAATGACAAGTCGCCTAACTTTCAGGACACATGGGCATTCTTG
GACCGCCGTGTAGACGAAACCATTCAGCTCGGAGAGTTGCCCCAGAACGTACGTAATGATTTTTTGGGTGTGCAGATTGTGCTATAAGTTGTAATGACTA
ACGTACTGCGGTTTTGTTTTCTTACTTAGCTGGGTGATGTGGCTGGAATGGCCAGCATTGGACTGCAATCGGTGTTTTCAGCTGTGACGTCTCTCGCGGG
TCCTCTGGCTGGTCAGATTATCACCAACTCTCCTCTGAATCGCGTCCCGAACCCGATCTCGGCTGTGGGAAGCGTGGTTCCTCCCTCAGTTGTGTCTGCC
GTTGCATCTGGATTGCCGTTCAGCGGCCGTGCCTCGGTGGGTGTGGCTGGAGATGATGCTATGGCTTTCCAGTCGAAGGATTTGAAGGAGATCAATGATG
AACTGGAGAAGCTTGGTGGTGCTGAGAGTGAGAGACGAAGCTAAACCACCAGGACAGTTTGCCTACTCTGTCTGCCATCATGGGCGTGTGAATTGCGTGT
CTCCTCCGCTATGGCACGCTTACAAAGGAAAATTAACCGGTCTAAGTAGAAAAACGGTATTTGAGCTCCATTGCCTCGCTAATCCTCTTCCTCCCTTTCA
CTTTCGTCCGGCTCGCCATCCTCTTCTTCATCGCTAGTCCCCTCCGCGTTGCCACTTTCACTTTCACCGCTGCCATCTTCGTCATCGTCGTTATTTCCAC
CGCCATCGCTGTCGCTACCGCTGCTTTCATTACTATTTCCCTCAACTTCTCGCTGCACTTGCTCCATGAATGCCTTTTTCGCGGCTGCCTGGGCCTCACG
CTTTTCGCGACGCGCACGCTTCATGTTGTCGATACGTTCCGCTACCTCTCGGTCCATGCGAGTCTCTTCAGCATCCCAGAAGGCATACTGCAGATCCAAA
GCGCGTAGGTCATCACGCACACGAAGCAGTTTTCGATACCAGAGTTCCTGATTCCAACTAGTTTCAGCTTTCTCCCGCTTTACGAGGCGAATCGCCTCTC
CAAGCAGCAATGGCGGCCAATCTGTGCGAAATATCTCACGTTTGTCCGGACAAAACAATCGACCTTTACCACAAATGCGATTGCACCTGAAAGTTCCGAC
GTACGAATATCCAAGGGCACTCGTTTCCGTGCCTTGGCCATGACGCATATTGTTGTAGAACTCGCCTTCATATACGGCACCACTTTGAAGCATTTGCAGT
TTACCCTTTCCATTACGTTGGCCCTGCTGAAATTCACCTTCGTAGCGATACCCACGCTCCATCTCCATCACCCCAAAGCCATGAAACTTCCCTTCCGCAA
ACGCACCAGTGTATTTAACACCGTTCGGATACACTACGGTGCCATTTCCACTCGGTACACTGTGCACGAATTCGCCTCGATACTTGCCGCCATCAGCGAA
GGAGTAAACCCCAAGAACTCCGTGCATTTCTCCATCTTTCCAACGTCCGTTGTACGTAAAGAATGTATGTCTTCCATGAGACTCAAGCTGGCCTCGTACT
TGTGGAGCAAGTCCCGGTGGAGCATTCAGTACTGGTACCTCTGGGATCAACTCCAGCTTGTCAACTTCGTCTTCTTCTTGGTTGTTACTGGTCTGATTGG
ACGGTGTTTTATGCGGGGGCTTCTTAACTCCATTGATTGCTGCCTGCTGCTGTCGTTTGCGAGCAATGTCTTCGTCAACGTGAAACGAACAGTCTCGAAA
TGCTCGCTGTAGCAGTAACTGGTTCTTTTGACGTGGCTCGAGCTCTTTCGAGGCGTCTGGCGCTGCCAAGTCGGGAGGTCGAGGCTTCATGATGGCGTCA
TAGTGCTTCTGGTGAGACAGCATGCGGATTTCAACAGTGGAAAGCTGCTCGGGTATCGCGAAAAACGCCTGCTCGAGGCGATTGAACAGCACAGCACTCC
AGCGATTTAGCTCAATCTGGTTTGACTTTAAAAACCATGGCGCGAAGCGTGCATGAACATCTGGCAGACCAACACGACGCAGCATACGATAATAGAAGAC
GCTACGAGGGTCTTCATCTTTGACTTTCTGTGCATGCACGAAGAATTTGGACAGAACTTAGTGATGTCTAATTTATTGCAACGCTGAAAACAACAAACAT
ACTCGTTGATAGGCGGCAAGACTCTTCCGGTCTTTCAGTATGAGTGCATTAATCTGTTTCACAAGCTATCGAGCGACCGAGAGTGTCAGCTCCACAGTAA
TTATCAATTGATATCTCCCTTACGTTGTGCATTTCCCTCTCGACGCGATTCTTGTCCTCCATTTCTCTCCTCATGATCTCGCGAAGATATCGTTGCCGAG
CCTCTTCTGGCGTCTCCTTCTTTGGCTTCTTGCGCCTCGTCCATGGACTCTGCGTAGTTGACGCCATCTAGAAGCTGGTGCTAGCCGATGTGACCGATTC
TACTACTAGTATGACTTGTTAGAGCGACGGTTTGCACGCCACCGCTCCATAGAAATAACACACACGTCTGTGGGTTCCTAAACTTTCTTACAGATCAGAA
TTGGTGCAGTAGTAAAATGTCGGAAGGCTTTATAGTCACATGCACACGGAAAAACGTGCTTGCAACCTCAAACACCTTACAGTCGATATGGCAATGCTTT
ATGTTTTATGAGCGGCTTCACGTCCACGAGGAGGGACCGAACACCGAGCGAGCTTGCGAGACTATCAATTTCTATGAACCGGAGACTTCAGATGAGTGAA
GTAAACGGCGTTAGCGTTCTCTCAGTGTTGTTTGAATACGTTTTTGCTTCCACATCTGACAGGTGAAGACCGAAGGTCTCCCTGGCTTTCAGTATTAGCA
TGGAAATTTTTACATCAACGAGAACGGAGAGGTGACGAAGACCTTTACTACCTTGAGCACTATCGGATGGAAAAGCAGAATGAGCACAGTGTCGGTCGAA
GGTGGCCGGCTGAAAATGATTTGACTGGACCAGCTTCGCCTAGCTGTTTACTTGAGTAGAGTATGATAATTATTGACCAATCAACTGTCGTTATAGGATA
TCCTTAAGATGGTCCAGCGAGCGTCCACATTGAGACGCCGGAGCTGGTTGAGGACATTCAATAGTCAACTTAGCCAGGCCGTACCGTGGGAAGTCCCGCC
CACCTCACGGTGCTACATGTACATGTACATGTATATCGTTGAAGGGATGCTGGATAACTGCTTATCGCCCCTGTTTCGCTACGGGGTTGCTCGCAAAACT
GCCTACGTCACTGTACAGTACAAACGGAAATCTACGAGATATGTGGTCAAGATGCCAACAACGATCTCTGATGGCGGTCTATTGTTTCCTTCGGCGTCAT
GAATCATGAATCATGACAGCCTCGCTCTGATTCAGAGTTTGAAGGCCCTTCAGTGAAGGGCAAGTCTGCCAAGAATGACGCCAGGCATGTCTACGGATGC
AAAAGGGGCAATCGGCGGGCAAATCTCCGTAGTGGCGCTGCAGATGCCGAAAGAGAGAGGATGCCGTTGAGAGCCTCCAACAATGCTCGCTCCACAGCGG
CATGGACACTGGAAATCCAGCTCACCAAGTGCAGGACACTGCCACCGAAATGACCCCAGCGGTCAAGTCCCTGACAGCCGTGGCTTTCCAGCCGTTTTGA
GCACGTTTTCTGCGCATCACTGGTCCCACCTCTCGAATGCCAAAACAGGGTACTGAAACTTACGAATTGTAAATGGGAGTGGATTAAGCGATGGCGTTGA
AGCCAAGGCGCGCTTCTGATTGGCGCTGCCCAATAAGTCGTTCTTGCGCCAGCTTCCCAGCTCCGCACGTACGCGATGGATCTGATTTGCTTGGCGCACG
CTAAGATCTGGGTCGGCTCCGCGCTGGCCGAGTCCACTCCAGGTCGCTTGTCCGGAGCGGCACCGGGTCGTCGCGAAAATCCACGCTCGATATTTGAGCA
CGGCACGCCACGCTACGCTGCCGCTGTCGGAACCAGCTGGCAGACCGAATGACTGAAGGAACCGTCGAAATTGCGCGTCAACATCGTCGACAATGCCTGC
TCCCGCCGGTCGATTGACTGACTGTATTGTTCGAAAATACTGAGCTGCACCTGAGTGACTGAGCAAGTTGCACCGCCACGGAGCACCGCCGTCAACGCCA
ATGTGGCGGCTCCATGATATGATAGGGCGCCAATAAGCCGCTGCGAGTGCAGGTGCCTTTGGCGCACGTGCGTCTGATTACGTTGTGGCCTAACTTTAGG
TCACACGACGCTTGACTTGCCGTCAAGGCACTCACGCCGCAGCCATTTGCCTGTCCATCTTATCTTGGCGGCTCCATCGCAGCCATCGCAGCCTATGCGG
CAAAAGCAACTTCAAGGTGTTGTCAGTGACCCGCGTATTCGGTATTTTGGCGGTTGCAGCGGCGTTGAAGTTGTCTGGAACTCCGACCTTTGCCTTGCAA
CAGACTTTTTGATTTTTGTCGAGCACGGAGAGAATTCACTCGCCTGCGCAGGGATTTTCAGCCGGCCTTCGATGCAAAAGCAAGAGCACCTGCTGACGCC
ATGACGTGTGTGCGGATCCGCCAGCATCAAGTGCAAGGCAATTACAAATTTTAGGGCCTGTGGATATTGCGTGAAAGGCAGGCACCGGCCTGTTGCTAAT
ACGCACTGGCGGTGACCGCTGAGCGACATCTGTACTGTCAACCAAGCCTTGGCAGTATGTACATGTACAGCAGCTACAGTTAAGCGCTGGCAAGTTCTAG
CGAGTTTGCCTACAGATCTCAAATGCCCAGCGGGGAAACTGCGCCGAAACGGAATGCGGCGCCGCTGTGAATTTCTGTGTGGCGTCGCGAGGAAGCTTGT
GGCAATGGGGAGGCGACCAGACAAGGTGGCACAGGTGGTTTTCCGCCATACAAGCTGCAAGTGAGTCCAAGCGTCGCGTCGCGATTGGCCTACAGCAACC
TGGCTCCTGGCTCTTCTGCGCCCCCAGCCCAAGCCCGTTCGCAAAAATACTCCTTCCATGGACGGCCTCATTCCGAGAACGGCAACCTCGAAAGCAAGTG
GCAATTCCTCAACTTTAGCCCTATTTGCCACCTTTGCCACATCTGGTGGCGCAAAAGTCAGCAGCTACATCCTCCTTTCCGCGCGCAACCACGGACCTCG
ACGCACTCCACCAACACACCCGCAGCAGTTGCACCCCTTCGGTACGTTTTGTTTGATGGCTTTTTCTCCCTTTGTGTCTCGTACGACGCCTCGGTAGTTT
GATGGCTTGAAATGTGGAGAAAATATAAACACTCTTCTTCCATTTCAACCCACTCATTCCCCCACTTTGCAACTTGCCACTCACTAACCGCGTTGTTGCC
CTGCCGCTTCCCATTTTGCAGCCGCCATTGTGCACGTCGACGAAACTCGCCGAGTTTCGCTGGATCCATCAGCAACCATCCGCTTCCCCAAGCTCTCCAT
GGGCTGTCAGACGTCGAAGGACGTTCTGCCCGCCAGCCCCAGCGACCAGCGCCCCAGCCTTAGCCAGATCTTCATGCAGGCCGCCTCCAAGCAGCAAGCG
CGCGATGACAGCGGCGTAGGAGCTCACCGCCCGCCCACCAGCGACTCGCACCGCGACGTCTTCAGCATCTTCGGCGAGCACGGCATGACGCTCGAGGCCA
GCGCGGGGATCGATTCCCCGTCTGCCAGCAACTGCTCGCCCGCCAGTCCTAACGGCAGCGTCTTCTCCACTGCCACCACTGCATCGGACACGGAGCGCAC
ATTGGTGCTGCACCGACCTGCAGGGCAGTACTTCCCTCAAATTCGCGTGAGTTACGGCGTCTACTCGGACACGGGTATGCGCAAAGACAACGAGGACAGA
CATACGACTACATCACGGAAAGTCGACGAGGACCACGTTGCCTTTTTTGGCCTGTACGATGGCCACGGAGGCCCTGAAGTCGCCGAGTACTTGGCGCAGA
ACCTGCACGAAAACGTGTTCTGCCACCTCGCAAAACCTATTTACGAACCGGAATCTGCACGCAGTTTGCAGTCGCCCGACCTGACTCTGACGGACGCAGT
CCGGACAGCTTACGCAGCGACAGATGAAGAAATCTTCAAACGACAATTGCCCAGCGGATCCACCGCAGTGTCGGTCGTGATCCGCGGCACCACGGCGCTC
GTGTCCTCTGTAGGGGACTCGCAGGTCGTATTGTCCACCAACGGACAGGCGAAGGATATGTGCATCGCCCACACACCAGAGCTCTCCAGTGAACGCGAAC
GGATTCTCGCAGCCAAGGGACAGATTTCCAAGGGCCGGATCTATGGAATGCTCGGAGTATCGCGAGCCTTTGGAGACATCGACTTCAAGACTGGAAGAGG
TGAATTCAAGAGCAGATTCAATGGTGACTTGGTCAGCGCCACACCGGACGTTGTCGTGCACGAGATCAAGGGCCAGGATGAGTTTATGGTTCTCGGTTGC
GACGGACTGTACGACGTCATGAATCCCCAGGATGTGGTGAACTTCGTCCGTGCCAAACTGGGTC