Description :
From Genome Similarity Track
Location :
Scaffold_36:26550- 32635
Transcript NameFunction/comments
Phyag_g925hypothetical protein
Phyag_g926hypothetical protein PHYSODRAFT_473874
Phyag_g927hypothetical protein PHYSODRAFT_353495

Sequence
6085 bases(100 bases per row)
gttgcagatggagaagccCGTGTACTCCAAGCTCAGCGagtatcagcagcagcaacagaaatGTACATCACTACTAGACGTAGCTAGACCGAAAGTACCT
TTGGAAGACGGGTGGCGGATCCCTCTAGCAGCTTCTACCAGCGTCCCGTGTGAGGCCTAGAAGTCGCTGTGGCTAGTAATTTATCATCAACAGTCCAGCT
TCATCATGTATATTTCACTGCAAGATCCACGAATCAACTTGCATACACCTCTTGTACAACCACACCTTACCGATAATCGAGCCTACGAAATGATAGTTTT
TTGCTAGCGGATCTTACTTCCGTACCATTTTGTCACCTTACGGTGATAATTGCCACAGCCCACATAGCATGCCTTCAAAAGAGATGCGACTCTCCGCCAA
TGAGCGAATGTCCTTTAGAACACGGATATGATCCTGCAACCACTTTCCTTAATCTAACCGTATTCCACGGCGCACTCGATAGCTTTGCTGTGCCCAGAGA
AGTTTGCGACCAAATACTTCACTtcaactgtagccatcttctgAAACGTACTTTATCGAAATCAACCTACATGTATATATGTAGGATTAATCCTACGATA
CAGTATAGCTTGTCAGTGGTTGGTACACCAATGGAGCAACCGCtgatcaagaagcaggagttCCTCGGCGCGGTGACGCTCGTGTCTTTCTCGTCGGATG
GGTCTTTTCTCTACGTGGGCGTAGGCCCGACCATTTTCCTGTATGCCACTGCAACTGGCGAACTCCTGGGCGAACACGACGTATTGACGCGCGGTATTCT
GCACGGCTGCGACATCGTTGGACGTCCTAGCTCAAGCGCAACGGATTCATTCATTGGTGCTTTCTTCGGCCAAAAGCGCGTGTCTTGCTATCAGAACTTA
CCACAgactgctgatgctgctcggGAGCTTGAGGAGTTTGCGGTGCTGGGCAAGCCGAAAGTATTTTGCGACTGGGTGTTCGACGTGCAGTTGCTGACGG
ATGATATTGCATTGGAAAGagacaacaagaagctgctggctgctgttgggcTTGCGCACAACTTGGTGCAGATTTGGGCCCCGGTGAACAACGATATTCT
TCGCAGTGTGCAGTGTGCAGAGCGCTGCATTTTGTACGCGCTGGCATTTCACGGACGATCGCTGAATGAACTTGTGGTCGCTTCAGGAACGGTGTTTCAG
CAGGTTTTATTGTGGAATCCGATGGAGAATGAACATGGCGACACCAACGCTGCTGTGGAACCGATGCAGCGATTGCATGCTCACGATGGCGTGCTGTTTA
AATTGGCATGGTCTACAGACGCGCGCGCATTGGCCTCTGTCTCGGACGATCGTACAGTGCAGTTATGGTCAAACAATGGGAAAACTACAGCTGAACAACT
GGGTTTGCCGAGAACATCAACCCGGGCAGAGCTGCTTACTAGTGAATACTATCCGGTTTTCCGCGCTTGGGGTCATTCAGCGCGCATTTGGGATGTTTCT
TTTTGGGAGCATGGCGTGGTAACGGCGAGTGAGGATGGTCTTTGCAAGCTCTGGGATCTTGACGGCAAGTGTGTTGCCACGTTGCAAGGACACATGGGTC
GGCATGCGTGGCGAGCTGCCATGCACCCGTCGCAGAAGATAATTGCTACGggaggtggagatggcgcgGTAAAACTCTGGAATGTATCACATCAGctcat
gtcgtcgtccgatGCACCAGAAACAAGCGACTCGTGTAAAACCATTCGTGTCCCTATTGCGACAACATGTACCGCAtcgaaaaagaagaagggcgGGGCA
TCATCTCACAGCGTGCGCAACGTCGTGCTCAGCACTCTCGACAACGGCGAAACAGCGTTTGTTGCTTCGGAACACGGCGAGGTTTTCCGACTGAACCTGT
CAGCACTCTCAGCAGAATTATTTTTTACTGCTCCTCCAATTGACTGTACTCCAGTTCAAACCCGAACGGGTGGTTTATCGACATTCGCACTCGATTCTAC
TgggcgcttcttgctgcttggtgaAGTAACGGGGCGTGTGTGTGTCGTTGAAGCATCCTCGGGAATTTTGCTGTACTCATGGATTACCCAAGCGAATGTT
CGCGTTATGAAGATTTGGTGGGATCAGGAAGACGCCCTGTTCGTTAGTAGTGCTAGTGGCATCCTCTCCGAGTGGAAGCCAACCATTGTCGAGGATAGCT
CGGCACCACGGACCATCGCAATGGATCTTGTAGCAAAGTTCAAGATCTCCGCCAAGAGCTCAACATCTTCAATTTTGGTGATCGACCGGGCGGCTACGAC
GAGGAATGTCATCGGAGGTGACGGGCATGGTAACGTGTATGCCTTTCACCGCCCGCTTGTTTCGACAGATAGAGACGGTCAACCCGATGCGGTGCGACCA
CCCACTCTTGTGCTTAAGGGCGTTCACGGgcgtgaacttgttgcaTCGCTTCTGCTTTCGAAGGAAAATAACGACACCGAAGACCACCACACCGTTATGC
TGTCGGGAGGCCACGACGGGTACATTTGCTCGTATTCGCTGGGAGAAGATGCAAGTGGTGTATTGACTGCTACACAAGTTGGTCGTGAATCCATCCGGGG
CATCTCTACGGTAAAGCAGCTTTGGTGGAGCCGATCCCccagcaacaacgccaagAGCGACCTCATGGTCTTTGGATTCCACGCCTCGCAAGCTGTTCTG
CACAACTTCTCTGCGCAGTATCGTGTCTTCAACGTGGAATGCGGTGGTTGGCGTCGCCCTCACGTACTTTTCACAAGTGCGAGCGAGGTAGACTCGGCTT
TACCCTCTCACACATTCGTGTTCACACCCCCAACAACACAGAAGCAACAGGTAGACATCAAAGTGCACTCGACTCTTTTGGGTGAACACTATGACGGTGA
CACTTCCCCTCTTTTCTCCAAATGCTCACTGCACGATCATCACCACGGGCGCATGACGACTTGCGTGGCTTTCCTCGGAAATGCGCGTTTGGTTACTGCC
GCAGAGGATAACAGCCTTATGCTGCATCGCCGACATGCTCAGGAGAAGAGCACAAGCTTCCGTTGGAGCAGCGTGGCAACAGGAATTGGTCATACCACTA
CCGTCCGGGCGCTTACTACGTTTCGACGCAAAATCCCTGGTGGCGTCGACGAGCACATTGTACTATCTGGAGGTGGAAAGCAGCGCCTTAACGTGTGGCT
TGTTCGTGGAGAAAGCGATCTTCTCCGCCATGTTTGCGGCCAGGAacgcgctgaagctgcacaagatcaTCGGATTCTTGGGCTTGCTACCTTTGCGATA
CCCACGGCATCGGATGCCTATCGACTTGTGACAGCCTGCAATTCTGAAGGTTCTACtcaattgttgctgctggacgtgaacCGTGGCAAACTTGTCGAAC
TTGGTGACTGCCGTTCCGTCTCAAGAAAACCGATTTTGTCCTGCGTTGGCTTTCAGgaaggcgatggcgatggcgttgttgctggaTTGGCTGTTGGATC
TACTGACGGTTTGGTGACGCTGTGGGACTTTAGCGCATTGCTGAAGAAAACTACGTCTCTACTTAAGTCGACTGATGATGTGGGGCAGTTCAAGGAGAGC
CTAAACGATATTATCAGCGAGTTGCAACCAAGTGGCAATTACTTGGCGCACGATATGGGCACGAACTGCATCAACCTCATTTCTTGCGCGAAGAGCGAGA
AAGGAGAGGGCCTAGACGTCACCCTTATTAGTGGCGGAGACGATCAGAACTTGCATTTGCGTGAACTGCGCTTCCCAGCGTGCGAGATGTTGCAAGAAGC
TCGAACGGTGAATGCGAGTGGCTCGGCTATCAAAACTGTCGCGTGCGTGGATGCCCAGACCGTGTATGCGGCCGGCTATGACCAACGAGTGAGCAAGTGG
CGAATTGATCGCGGTGACAACAGCACTGAGCTTCAATGGCAAGGCGCTGCTTTCTCTGAATGCGCAGATATTGCTGATCTCGCTATCCGGCAAACCCCAA
CTGGAACCGCTGATGAAGTTGTGGTCGTTGGCCAAGGTCTGCAAATGGTGGAGTTCCAGCGCCCATAAAGGATAAAGGAGTATCCTAAAGAGGAATAGAA
TTGCATGTATTTTTCTGGGGTTTTGTTCCTAGGAAATATCCACATCGCCATTTGGaccacacagcagcaaatacTTCTGGTCGTTCTCGGAGTGGAGACA
TGTTCAGCTTCTCTGTTTTGTTGGCTTCATCTTGCCATCATACTCCTTGTACAACCTCGAAACATTCAGTGACACCACACCCTCAGTTTCGAGCGCGCAG
AGTTTGTGCAACCACTACAACGGCGACGAAAAAACTCTTCAACCAAAATCCAGTTTCCCGCACGACGACAGCATGTGCAGCCTATTGACCGAAGGTGTTC
TCGCCGCTGTAGGTGATGTAGAGGAAGCCATCCACGTCTTTCTGTTCTTCGTAAATGTTCGACATCAACGCAGCTACACATAGCAAACAAAAAAGAGAGC
AAAAAAATCGGAGTGAGAACACAGCACACATTTAGACGCCAAGATTCATTGGCTCATACCGGTGGGTGGGAGGACattgttgatgaagatgaagattgCC
TTCTCTGGACTCAACTTGATGCGCTTACGGATCACGTACACGAACTGACCCACTGTGAGATCGGCTGGCACCAggtacttcttcttgtcaatGTCCGGGA
TGTCACTGCGATCCGCCTTCTCACAAATCACCTGCAGGGCACAGCACCGCATCTGTTAATGCTACTCCAGTCCACCAGTATCTACACAATGAGGCAACGC
ACCGGAATCCGGTCCGGGTATTTGGATCGAATGCGTTGAGCCTCTGCCTGGCGCTTCTCTGCAAGAAAACCACACCAtcgaacgtcgtcaacaCTTCCCG
CAGCCTAATTCGAAGCCTGTAGAGAAgtagagagagagagagagcgaCGTACCGAACGGGTGTTCCTTCTTGAATGAGCTCATTGTCGTGGCGGAAAAAA
AAAGCTGAAGGCGTGTTCTTCTCCTGTTAGTGTGTCTCCGAGATCGTTACGTCTGTAATGAGCCAAAGAGCAACAAGACAGCGTCTCCAGTCAGTCTCTT
TCCCGCATTATCTTCGTACGAAGGGTCGCGCCACGCTATTAGCAGTTGGAATCAGCGCGAAGCAACCCTTAATAGACGCTAAATGCAGGTGGTGGTCGAG
TCAGCTCCAGTTGCGTCTTCTCGTCTCGTAGCGCGATTGGAGAGGCGCGAGCTGCGACTGTATGACCGCCACACGCACGCGCACATATACAGGCAGGGCA
GGACCGCAGCGGTGCAGTGTGGAGAGCGCtagcgccgccgccgtccCGAGTCAGATCTGGTTACTTGCCTTCGACGTTTCTTCTCGGCGTTCCCACTTTC
TTTGTGTTTGGGGGGAGACCAAAGGCAGAACAAGCAGGTTGAGGCAGAACCCTAATCCACTGCGAATTATCCTCTAATTCGGACCTATGAGACGCTCATG
CAGACCTTTATGCTGGAGTTTGTATGGATAAGGTCTTCGAGAACGGTACATAATTCGTGGCTGAGATACGTAAATACGAGGACGAGAAAGATCAACACTC
TGCACTTCTGGTTGAAGAAATCATTCAGGACAGAGCTCGTCGAGGACAGGTCGCCACCATCTTCCCGCGGCTCCCAACGCAGCGTTTGCCTCGCCCAAGT
TCACTGCAGCATGGCTGTATCCAGGAAGAGCCGTCGACCAGCAAGCGATTCGATGAAGCGGTGACTTTCTGCCGGCAGGGCGGTGTGTGTGACGATAGCG
ATGGATAcaatcgctgctgcaaagagTCCACGATCTCAACTGTGTTGGGCACGACACTTGTTCCCGTGGTAACCACACTAGATTCTTGGCGTATATTTAG
CCGCAGCACCAGGCTTTGTTTTTCATGAAGCTAGCGTCGAAAACCAGATTGGCCTGCATGCAAATCTGTGGCCGTTGGAACGGTTCTACTCGGGGCAAGG
AGCAGCATGGGGCTTGGAGTGTACGAATTGGCTCTAGACTCAAGCTAAACCATGGTACAAGATCACTTCACTGCTATCGTCTCGA