Description :
From Genome Similarity Track
Location :
Scaffold_254:26546- 36583
Transcript NameFunction/comments
Phyta_totarag6239hypothetical protein PHYSODRAFT_558872
Phyta_totarag6240hypothetical protein PHYSODRAFT_496396
Phyta_totarag6241phospholipase D; Pi-TM-PLD
Phyta_totarag6242tubulin-specific chaperone D, putative

Sequence
10037 bases(100 bases per row)
GAAGACGATGAAATTGTGGAGGCTCTCAACCGCTACACCGCCAAGCTGCAAGATAGTCTCAAGGTCATTACGAGCCCAGACGCGTAGGTGTATCGTTCGA
ATCAATATGCAATTATGAATTGGCGAGATGAGAGGTCATCTATGCTAGCAAGCGGTCGGATTCTTGTGGAGAGGCCAGATCTTTCTCCTTCAGATGCGAG
CGTGCAACAGCTTTGTAGGCCTCTTGCTGCCAGTTGGGCTGCACGAATGCCGGGATGAAGCTGACACCAGACGCCACTGTGTATCCGCATATCATGCCTT
CCCAAAGGCCTAGCAGACTGGGGTGATCTGCATGGACACCCATAAAGTAAGCTGAAGGTATACCAACCAGCCAAGCACCGGCAACCATTCCCACTGCAAG
TGGCATTGGCCGTGCTTGTGCTTGCAGGATAGCCTGTGCATAACCAAATTTCAGTTAGATTACCAACGTTTTCATCCACGAGAGAGAAAATCTTCGTAGA
CTTACCAGGGCGTAGCAGAAGAAGGTCAACACAAAATACGCAAGCGCTGCGAGTGAGCAAACCTGACTAAAAGTCGAGGTGACCTCTGGGTCGTCCGAGA
ATATTTGACCGAGGTGCTGCCGCGAGCTAACGATGACTACGCTGTTTACGGTGGTGAGTGTGGCGATGCAGATTCCACAGATTTGAGCGACAAGAATTGC
TTGCGACGGCTGGCCAGCTCCAAGATGGTTCCCTATCCGTGTAACCGAGGCACCGATAACAGCGTAAAGCGGGCTGGTGGCGAAGTAGTAGAGCTCCATC
ATAGCGTTGTGCGTTCCTAGCTGGATCTCACCGATCTTGGCGGCAAAAAGCGTCAGCACGGTCAACTGCgcgttctccagcaactcgccGGCTGCAAGCG
GCATGCCCACTGATACCAGGTTCCACACGATCTGCTTGTCGAGGAAGAGGGTGTCACAGCAACAGGAGCATTGTCGGTGGTACTTACGGTAGACGTTCAT
GTACGTGACGTAGCTCACGAGTCTCAGAGCTACTGCCACCGCCGTTCCCAACGGGCAACCAATGAACCCAAGCGTGGGCAGTCCAAAGCAGCCGTAGGTG
AGCccgacggcgaagaagcagttgaagatgACCATGAGCACGTCGAAGACGGCGGTAGGCAGAACGATGTTCTGCGCCTGGTAGAAGCTCGAGAGCACTT
GGAACATGCTGCGCGGCCACAGCCAAAGCAGCGACAGTCGGCCTTATTGCCCTGTCAGGCAGGCCAGTGTTCTGCAACCCCCGCCGTCAGGAGCAAGCTG
TCGAGGTTCCACCAGAGCAAAGCCATCGGCGCGCAGGCCATCGTGACCAGAAGACACGTGAGGAGCGTGTACTCGCCCACGAGGTGGTAGTTCTTGGCGC
CGAAGGCCTGAGAGCAGAGCGAGTTCATGCCGCCGTTGAAGCCCTGCATGAACACGAGCGTGGACAGGTCCAGACACAGCTGTGCGTACGCGACGGccgc
cagctcgtccacgcccaGGTGCCCCATAACGCTCAGTTCGGTGATGGAGACCGCGAAGTAGCAGTACGTggacagcgccagcagcgctcggGATTCTTGG
CGATAGATCAGCATCGAGCGGGTGGCGCTGCTCGGTTGGGTTATACGGATGTAGCCACCACGGCCGCGCCTTTTCATGAtattcacttcaacttcaaaga
TCACTTCAGTTGAAATGCTGAAGTGAGGTACGAGAATGCTTATCCTGCTGTGGTGTTATCAACGACGGCCGTGCCTTATTAATAACAGGGATGTCTTCAT
GCCATACTCACTGCACGTGAGATGAAAGGTGTGCGCGCAGTTGGACTTGGAGCCGATAGAAGCTAAGGCGCTCGGTCTGTTCCTTGAAAACTCCTCTAGC
TATTAGCCATAATTTGATACTGTAATGTCATTAGATGCGCTCTGAATGCGTCGAGGCTACCTGCCCTACGTGTATTACACGACCTAAGCTTAGTGGTAAA
GAAATCGATATTGGGCAACGACGCAGAATGCTTAATTACTGGAAGGCAAAGACTCAGCGCCGTTGAATGCAAACACAAAGCTGCAATGTGGCACCAAGCA
AAATATCGCTTGGCCAGCATTTTTCTTTTTAAATAGAACATTAGATTCTCGACTTttggaatatgaaaatgaccagatGTCGCATAAACTACTGATTCCA
CAGAAATAACGACCCTTGTTGTTATTCCAACGAATTTTGAAATATAACGGTAGTTTATCGAAAGTAATAAACATATTTTACAGCATTTTCCTATTAATAA
TTCCGAAAGCTCTCTattttattaataactaTAATGATAGAGGGAAAACTCACCATAAATTACCAAGCTCCTTCATGCGGAAATTCCACTGGAATAACAG
CGGTTATTTATCCGTTATTTAATCAGATTTAAAATGATTTTATCGGATTTTCCTAAAGCCCTCTAATATTGTTTTAATAAATGAGAGAGATTTAGATTAT
GAAATGACTGGAAAAGGAAAATGACCAGATGTCGCATAAAATAGTATACCCCCATTCTACAATACCAAACAGTTTTTTGTGCTAAAATTATAAAAATTAA
ATTTAAAGAtttaataaaaataaaaaccATATCCTGAAATTTTTAAATTGTATAAAAAACtaaatttaaaaaatatAAATAAAAAGCACCAAATAGTCCA
CATTAATTTTATTATTAGGTGTATTAAAGATTTTTTATAATATTTTAGTACATTTGCAGCTATTTCTATATTTTTTAATTATATCTTAAGTATAAAACTT
CTTTGATAGGATTTGAACCTACAACCTAATGGTCTAGAATAAGAATACGCGGAATATCATAGTGACCCGAACCCTTTCCTGAAATAAAATCCAAATGAGA
TAAAATTCTGGATTAATACGTTTTGTGGTCATGCTAACTTTTTGCCAAAAATAACTTCAAATAAAACAGCGCTGATGGCTTCTGTTGTTATTCCATAGGA
ATATGATTTTGGAAATTTGCGGTAATGTATGTAAATTATACACTTTTTATGCGGTTGTGAAGGATTTTTCTTTTTCCAAAGTGGATATTCCATAATTAAA
GGTCTATTTTATGTTTAGAAATCAGATACCCTATCGTTCATATCATTGACAGGCGACACATGATTTTCACTTCTTTGCTTGTCGAATATCCCATAGGAAT
ATGATTTTGGATAGCGTtaatttatccgtaatttatacACAATATTTTGCTTGTTTTATCGGATTTGCCCTATTCCAGACAGGatattccacaaactaaT
TTCGATTTCTAACTCAGATCGAGCTTATCAACCCTCGACGGGGTGAACAACGCCGTGGCGACAGTAAGCAATCCATGACATCTCGTCCATCTGTCTCATT
TCTCATGGTCTGATTACACAAAGGATCTCTTCAGTCTGCAGTCCCTGTTGCTGCGCGCGTGACGTGCAATGGCTCGCGCTCCTCCGTCAAACGCGACGGC
TTCTGCCTCGGAACTCACACCGCTGCTCAAGGGCGACGTCCGGCTCACTATCTCCCCCACGTCCGCGCCCTCGTCCGCTCACTCGCCACCCTCCCGCCTG
CCGCGCTGGTTCGTGCTCGCCATGCTCCTCAGTGTCTTGTGCACGCTGGCGTGGCTGACGCTGGTCGTGCTGGGCCCGCAGCTGGACCTGCACGTGGACG
CCACCGCCTACCTCTACGCCGGCGTTctcaactcgctgctcggcagcttcttgtccgcCAGCGGCTACTGCTGTCAGAAGCACGCGCATATCCGCGTGGC
GCGCAACTCGGCGCTGGGCACGGCCACCATGCAGACGGCCTTCCTGGCCGGCCTCTTCCTGCTGGCTGTGGGCACCATCTCGGCCGTCCTCAACCTCGGG
ATCCTGGGACAAGCCGTGCAGGCGCCCTTCGCGGCGCTCACGCTGATCTACAGCGCGCTACTGGGGcgcttcgtgctgcacgagagcTTTGGCGTCTACG
ACTTGCTCTCCAGCGCGCTCATCATCTTGGGTGTCGGCGTTGATGTCTACGCCGCGCAACTCGCGGACGTCCCGCAGACGTCGTACACGCTCAAGTCGCT
CGGACGGCTGCTGATGAGAGACTCAATCTTCCCGCTGGGATACACGGTCATGGCGCTCACGTacgcgatgctgctgcttcgacgcGTGCACacggacaag
ctgcagcgccatccgATCGGACTGCTGGCCTTCAGCTCCTGTGCCGGAGTCATGGCAGgcttcacgtcgctggcTACCAAGTCGGTCGTGGAGGTGACCA
AGACGGCGCTGAAGCACCAAGACTGGCTGGTGTTCCTGAACCcgttcttcatcctcctgGTGGTCGCCATCCCGTGTGCGCTGGTGCCacagctcttctt
cctgaacAAGGGACTCGAGTTCTTCGGCACGCTGAAATTCATCCCGCTGTATCAGGCTTTCATTATCATCGGCAACATGGGCTGTGGCATGGTCTTTTAC
AATGAGATGGCCAACTACAGCTCGACGGCGCTGACGTACTTTATGGGCGGCATCATGATCACTATCTGCGGTGTGTGCGTATTGCTGGTTAAAGTTGACT
CTGAGAACAGCCGTGGAGACGGCCGACGCTCGAACGCAGTGAAGGCGGTGGATCGCCCGATGGATGAGTTGCTAGATCGCAAAAGCAAGGATAAGGAAAG
GTTCGAGACGGACTTCACGTTTGAGCAGATGAAGTGGGCCGCGGACAGTGACGGATCGAAGCCAAACGAACTGCGCGTGTGCCGCGACTTCCGCGAGTGC
CAAGAGGCCATTGTGGAGCTACTGGTATCCGCGCGCAAGTCGATTTACTACTCAACCTTCCTGTGTGACTTCACCCAGGTCCTCCACACTACAAATGAGG
AGCACACCGGCAACACATTTGTGTCGCTTGTACGCGACGCCGTGAAGCGCGGTGTTGACGTGCACATCTTGTACAACCCAGTGCGTGACTACGGAACGAA
TTCAATTGCCGATCTGCGTCTCAACTTGCCTCAAGAAGTGCATTTTGCTTGCTCGGTCAGTGACCTGGGTCCGAGCTGGTTTACACGCCACTTGTCCAAC
AACTCCAGGTATGCTTTCCACCACCAGAAGTATCTGTGCATTGATGAGGAAACCATCATGGTCACTGGCTGCGACGTGAATACTGAGCGGGAGGGCTGGC
TGCGTAAGAACCATCTTGGATACTATTGGCACGAGCTCAGTGTTATCTGTCGTTGCACGTCTGAGATGGTCAGTTGGATCCACGCTAACCACAAGCCTGC
GGAGAAGAAACGCTACTACGATCACTTCATGGAGTCCCCGCCGTTCCCGCTGGTATCCGGTGGTTGGCGAGAAGAGAATTGCATGGTCAATATGATCATG
AATGCCAAGCACTCCGTGCAGTTGGAGAGCCAAATTATGATCTCGGGTGGCTCACTGCAGCATAATCGCATTTGTCCTGCGATTGTCGCTCGTATTAGCC
AGGCCCACCGCAAGAGCGAGCCATTCCACGCGCTAATCCTGACAAACGCGGCCCAGAAAGATGAACCATCATTTCTGGCACGAACCTACTGCACGCTTTC
CATCCAGTGGTCACTagagcagctggaggactGCGCATTAGCGTATGGCCTTACGACAGACGAGCTATGGCAGCACCTTCAGGTGGGCCGTCTCGAGCAT
GACCGTGTGCTGGTCAAGGTGCATTCTAATATCCTCATTGTGGACGGGAAATACGCGCTTAGATCGTCGTCGAACCTGGCCGACCGCAGTCTGAGCGCGC
GTCCAAACGACACTGAGCTGGGCCTTCTCTTTTCGGGACCTCGTGtgaatgagctgcagcaagaccTTCTCAACATGTACTTGGGCACGATCGGCGAGAG
TTACTCGTGGAGTCAAGTATTCCAGCGTATCCGGGGCACTGCAACGAAAAAGCCAATCGGAGTGATTAAACCGCTAGAAAAGAAGTCATGGAGTCCTGTG
TTCACGTGGTTTATGATGAATGTTTTCATCTACCTCAGTGAAGGCGCTACAGGTGGCCGAGTCAAGGTAACCTACGAAACCACGGTCATTGGCGAAGACA
AGCATGAGTTCGAGACCTGAAGTGCGACGCACACACTGCTGGGGATATATGTACTTGGAAGTATATGAATGCTCTTTTGCAGGTTAAACTTGCTAATAGC
CCATTTCTTTGATGAGGGTCTTGTAGCTTGCATCTTCTTgagtagctgctgctgacctcgcttcttctgcggGCACGGGCCTGCATAGTCGCATCGATTA
TGAACTGGTAGTTAGTATATGGCACACAACATTGTGTAAAACAGGACGGCAAACATACCGCTTCTTCGAGGGCAGCTCCATGTCTAAAAGTTCCAATAAC
TCATTTCGAGCGGTGCGCACTTGGGAAATCTGTAGCGTACACGGGACGAGTTATTAGCTGCTCGCCTCGAAGTGCACGGAGTTAGGACGTACCGAAGCGT
CCCATGCGGTGTCACTCAAGATCTCGACCACTCCGTCGTACTGCAGTGAGGATTCACGCGAAACAAGTTAGCTCCTGGATAGATGTCAGCACAGCTGAAA
CACCAACCTTTTCTTCGATGACAATCTCGTCGTGTAGAAGCAATCGCGTGTAGAGCTTCTCGGCAGTCAGCTTGCGCACTTTTGGGAATTTGTGCCCCAG
AAACAGCACCAGAGCTCGTAAAGTCTTGATTTCAGTTTCGGGGTCACTTGGGAGTAAACCAATCAGCACGCTTATCGCAGCACTGAGTTTTGGGACTGCA
GTACACTTCTGAATCTCGTCGCGCAGTACATCATACAGACGCCCACCAAAGTCCGTAGTTGCTGTAGCACTGCCATCTTCTGCCTGGCGTTGTTCGAACA
GAAAGCGCAGTAGGTTGGACTCCAGCAGAAGTGCCATCGTTTTCATAAGCGGAATTGTGACACGGTCATCCTGGTGGTGGCGAGTCAGCAATGTCACTAA
GAAAAAGCTGAACCGACTGAGCAAGCCGAAGTCTTTTGCCTGCAAATGCGCGCGCATCCAATCAAAAAGGGCGCCCTTCGAAGCCTTAACGACACTCTCG
GTTAACCCACCCACACTGATGACGAGGCCCGCGGCAATTTCCTCCAAAAATTCTGGAATatccatcatcttcactACTAACGGAAAAGTATCGTGGGCCA
TGGACCAGTTCACCGTCAAAGTCGAAGGAAAAGTCTGGTTTTCGAGGTGGAATCGATCCGGGATACCGTCAACGCGAGGGGAAGTTGAATGAAGCAATCG
GAATAATATGTTTCCGGCTGTCATTCTCATGTTATCCAGCTTTTCAGCTAGTTGCTTGGCAAGGGCTCCAAACTATTAAACACGATAACGCAGGCAGCAA
AGTTAGCTTATACAAATAGTGAAAAGAGCATTCAGGAAACGTACAATTGTGCCCACAACATCGGGAGACAATCGCCGAGCAAATGGCATCAAGGATGTTG
GACTTGACCTCGTGTGCTCTGCAATCTTCGTGCGATGCGCCAAGTCTGGGATGTAAAAAGCCCCACTTTCGGAACTCTGCACCGCTTCCTCTATTGACAG
CCTTTTCGAGTGAATAAGACCTACTCCGGTAGGGCCGAAGTAGTAATAACCCAGAGCTGGCTTCTCAAATTTGACGTAGCATATCGGATCGAGTTCCAAC
GCACCGCTGACTTCTTCGATCTTGCGCTTTCGATCTGATAACCCGTCAATAATTAATCCTCGGCCATACTCTGTCTGCGCAACCGCGCCCACAAGCCGGA
AGTGTTGATTTTGCACGTGTGTGATTTCATCAagtagcagcttctcgatACCAACCATGGCTTCTTTGCGGACCCAGGAGCCGACATCTCCACGCTCATC
TACTCGATAATCTTGATGGATACATCGGACGAGTGTCTGGACTACATCGTCTTCGAAGCCGTTAAGATCAAGCTCAGCTGATGGCCGAGAACTCAGATCC
ACCAGTGCTTGaactgcagccactcgacTTCCAGGATCCTCGTCTTCTGTAGCACGTTCCTCAAGTGAAACCGATCGAAGGACTGCAGCAAATACCTCTT
TCAGGCAAGGTTGGACTAATTCTTTAGCGGCAACACCTACAGCACGTAGAAAACCTCGCCGTGCAGCAACATTTGGATTCGGCACTTCGACGGGCACACC
GTTCTCCTTGGATGCCACCATGATCCCAGAGTTGATGAATCGCGGTATCAGTCCCTGCATGTATTTTACGTGTGCTGGACTGCCCTTTGCAAATATCTTG
GGACAGTATTGAGTAGTAAATGCACCGAAAGCATCAATAGCTGCATCACGAACACTCTCATTCGGGTGCACAAAGCATTCTTCAAGCATCGACAGATACT
TCTTCACATGAGCAAATCCCAGACTCAATCGAGAATTTGAGATCACTTCAATCACATTGCACACAGTGGTCCGAATCATCTCACCGCCGCGTCCACGGAA
CAGACGCCGCTTATCAACCTCAATGGGCAGCATCTTGACCTTCTTTTGTAGCTCCCCGTCAATAAACACAGGGATCTGAGCCAGACAAGTGAGTAGCTCC
GCGATACTGATGACAGCACCATGTCGAACGATTACTTCGACATCTGGAGAGAGGGCAGATTCCAGAAGACGCGGAAACAAACGGGTCATGGCATTTGGCG
GGTCTATCGCCCCGATTTTACCtagcgcagcagcagcaagaccgCGGATCTGGGCATCCCAGTGAACAATTTTAGAGCTGATGAGGTGCTCTAATAACGG
GTATCGATATTCCGGATACTTCGCGACGAAGACACTCACATCCAGATACGCGTGACGTAAATTTGCCACTGAAAAATAGTCTGCTTTGGTAAGCAAATCG
ATACCGTTTGGGAAATTTGTGCGTCCTTGCCGCCCAACGTTTTCTTGGAAAGCCGCTGATGAAGCACGACGGCAATTCAACTCGCGGTCGAACACGCAGT
TCATCAGCATTGCTGGTGCGAGGACTTGTTTCAGCCAAGGCAGAAGCAGAGATGGCTCGTACGCGCGTGCGAACGACCAACACGCGTAGCAAGCAGCGTC
ACGGACATGGGAGCCGATACTGTATGTACCTTTTCGAATGTCGTACTTCAGTGCATTAGCCACACAGTCCACTGCATCGGGTAAACGCTGAGGTAGCAAG
ACACCACGGCGAGCGAGTTCTGCCAGTGCCAGACTGGCGCCATGCCACGCACcgtcatcttcagtggcCACAAAAAGTTCCAGCACAGACTGAACTATAT
CGTCCGCGAACTCATACGGTAGGCGGCCAGTGATCCGCCCAATGCCCTTTGCTGCTGACCACCGCACCACTGTATCTTTGTCCCGCAATCCACACAGAAG
AACCTCAACtatctgctccagctcttccaccacttcaaaagcatcatcgtcgtcatcttcgtcattACCATTTGCATGGCTGTTTTGCGGGGTTGAAGTG
ACAGAGTTGCTCGTAGCTAGTCCCAAAGACTGCATATTAAGCTCCAACGACCGCAGACCACGGCTGTAGCGCCATGACCGTATCTTCGGCGGCAAGTAAA
GTAGCCCAAGACGTTGCACAAGCTTGACGCTCAGTTTTCGATGCAAGGTACTGCTGGTCGGATGGTCCGATCGCGCATTATCATCAGTGAGATGAGCCAC
CAGCCTCATGATGGTGGCAAAATAGATGCGACTGGCCTCAATGTGCTGCTCACGTGGCGAGTTCTTGGCGATATGAGCGAGGCAGAGCATAATCCCCGTC
ACTTTGAATTGCAGCACACGCATATCGTTGCCTTCGGACGCCGTGATCAGCTCTCGATTCGCCCAGCTGAGGAATTGCGTCAAATAATGCTGTTCCATAT
CTGGTCTGCTCAGCAGTCGTGATAAACACACTGCCGCCGCAACTTGGGTAGCGCCTGGATCACTCAGATAGTCCTTGCAGAGCGTGACAATATTGGACAC
GATCGAGATCGTTCCGTTGGTGCCGTCACTGGCACTA