Description :
From Genome Similarity Track
Location :
Scaffold_55:2654- 8945
Transcript NameFunction/comments
g6432.t1XP_009527712.1 hypothetical protein PHYSODRAFT_501310 [Phytophthora sojae
g6433.t1hypothetical protein
g6434.t1hypothetical protein

Sequence
6291 bases(100 bases per row)
TCCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTACGCCCTTCGGCGGAGGTGGTGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGTC
CTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGAACCGGACCTTGGGTCTGGTTCCGATGA
CCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGTGGGGGGGCGGGAAGACGCCCCGGGTTTGGTCAACCAAACCTTG
AGTCTCGCCTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTAAAGGCTCAGCTCGCGGAGGTTGCGCA
GACGACCTCGAACGTAAAGGTCGAGGTCGGGACGAGGCTATCTGCCGCCTTGAAGCGCGTCGCCGCGCTCGAGAGAGCTTTGGCGAGTCACTAGACGTAG
GTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTT
CGCCAACACGGTGAATGGCTCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAAGAGAACT
AATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACC
GAATTACAGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTG
ATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTTGTCGTCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACA
TTGCTCGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGTACCGAGTATGCTCGGTACGCGTG
GGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATG
GAACGAGTGCGCGTAGCTCTTCATGGTGTCAAACCAGCACGCGGTTGACACGTTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAA
CTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTGAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAAC
ACCATGTCGACAAACAGACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGTTTGTTGTC
TTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTC
ACGCGCTGGCATACCTCGCAAGCACGACCGTACTTGCGTACCCATTTGTACTGGTGACTTCAGTAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCAC
GGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGATCTTCAACTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTC
GACTGCGCTGTAAAGCAGCAGATCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTG
GAGCAGTACTCCAACAACTGCTTCGCATCCGCATCATGCGCGTATGCGGCCTTCACGTCATCCAACAAGGACGACGAGGGTGTAGTCGTCCTGACGACGT
CAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCGGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAA
GTTGTACTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACG
AATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGGGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCT
TCAGCTGACGCGATTTGTAGTAAACCACACGATCATGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAAC
GTGGAATGGGCGATCTTGGTCGGTCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCC
CATGCAGCCTCTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCG
CAGTTCCTTTACATTTGAAGGCGTAGGCCATTCATTGATCAGTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACG
GGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCT
CCACATCCGATTTCCAATTCACAGCCCGGCTGTGAATGAACACGTCGTCAAAATAGCTCGGTGCGCGACTTCGCACCGAGCGCAACAAGTGCGTGACGCA
CCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGTATATCG
CTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGACGATAGTACTCGAGGTCATCGAATCGATGGTCACATCTTTTCGAGGTA
TCGGCGTTTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCATCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCT
GTGCGGGGACTTCGATTCCCGCACTTGTCCTGCCTTACGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCGACGCAAT
ACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACCCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAA
GACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCACTGAGGGCGTCCGCGCCCTCAGAGATG
AGCTGATTCAGCTCTTCTGCTTCATACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGGTCGCGAGCGAAACGCT
TCCAGTTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATCCAGCCTAATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAA
GACATTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCTGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTGAT
CGCTTACGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTGCTTGTATTCGCCGGCGGGTT
TTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACG
TTTGCAACCGTCCGCACTGCTTGCAGCGTTGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTG
TCGACATTAGCTGTCGACACTACCGCGTCGCTCCGGACGCTTCGAGTCCCTCTCGAATCGGATTGAACCAGGCCCTGCTGATTCGGTTCACATCTTTTCC
CAACGACTCTCGCAGTCGTTGGCGTTCGCTTCGGGTGACCGGAGACAGCCGCATTTCGCGCTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCGTG
TGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCTGAAGCACACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCA
AGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATATGAGAAGCGTACGCGTAC
GATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTATTTTCACCTCCTCGAAGTCAAGCCTTGGAAGACTC
TGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGT
CATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTCCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCG
CCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTTCTCGCCGTGTGCACAGGTGCTGTGCACTCGC
GGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAGCCAGCAGCTGTCGCACTCGAGAGGTCCATTGG
TTCGGGACCTCCCGACGGTCTTGCCACCGGTCGTGGCATTAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCA
AGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGGAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCG
CCTCGTCGATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTTTGGGCGTAAGCATGCACGTCATGCTAGCCCTGTTGCAGATCGAGGAACTC
CGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGG
CGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGT
CGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGA
CACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCACATCGTTGCTA
CCGCCGCTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTG
TTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAA
AGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCTG
TATACTTGTATCCACAAGTATACTTAAACCTAGATAAAAGAACCAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTC
CTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTAC
CAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG