Description :
From Genome Similarity Track
Location :
Scaffold_258:26535- 49066
Transcript NameFunction/comments
g12209.t1hypothetical protein
g12210.t1hypothetical protein
g12211.t1hypothetical protein
g12212.t1RAW25647.1 hypothetical protein PC110_g17937 [Phytophthora cactorum

Sequence
22531 bases(100 bases per row)
CAATTTTGATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCCCCCCCGTAGACAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCGTCAGC
GACTTCAACCATCTGCAATCGTCGTTCACTGCGCCGGGTCCGCAGATAATCATACAGTAACCCGCCACATGATAAATTTGAGGCAGGTTCCCACGTGGGT
TCATCATACCCAATCCACTTCACCTTGAACTCTCGGACAGCGCGGCTAGTGCCCGTCGACAGCGGGGATCGGTCATCGAGGATGGTTTCTACCTCATATT
CGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCTTCGTCGAAGTCCAATCTCGTATCCTCGGTCACTTCAGGTGCTAACCGACTCTT
CGGTCGGTCTCCGAATTCGTTGACGGCCTTGAGTCGGGACACGTGTACCACCGGGTAGAACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCA
AACTCTTCGATCTTTTTCTTGATCCTGAATGGCCCATGCCATCGGTGGGCCAGTTTCTTGGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTC
TGCTCCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGGTCAGACGTTGCCCCCGTCTCCACCTGTGACTCGTCAGAAGTCTCGTTTTCATCGAT
ATTCGGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGAGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCAC
GAGATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGG
ATTGTGCGTCCCACCCATGGACTAGGTAAAACGGAGTGTCCTTCTGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTC
CCAGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGACCTTTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTC
AGGGTCGCTCTTGACCGAGACTGCATCGTCTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATATCGGATTAGAGTTGGTGCTC
CGAATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCTTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACAAATCCTGTGAACGCGCACTG
GAACAGTAGTAGGGCTGAGTTGCCCCGACGAGACTTCGGTAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGCTCTGCTAAGACATTTCCT
GGCGAATAGCCTCGGAACTGTGGTCGACTTTTCTCGAACTACAGTCGGGGCAGGACCTGACGTGTCGTTCGGCGTTTGCATATAGTCCAATCCAAAAATA
GTCTGATTTGACTCGGTGGTACGTTCGGCCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGGC
ACCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGTTCCCAAAAAATACAGTACCTCATCCTCGCTAAGCACGAACTTGT
CGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCCGAGGACCGTTTTTAGGTTCGACCATCTCAGCTCTTCATCCTG
GGCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACATCTTCTGCGTTCGGAGCGCCAGGGTCCGCCTCGTTGCTCGATTGCTCG
GCTCCCAGCTCGCTCTGAGCTTCGGTGGTCACATCATTCGCTTCGTCTCGCTCAGCTGCACCATTCGGCTCTATCACCGACGTTTCATCTGCAAACTGGA
CTCGTTTCTTCCTCACTTTTGCTTGGTTTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATTCC
ACGGGCTACTTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCTGTGGTCTGTACTGAGGGTTCATAGATAACCTCTCCGATCCGGTTCAGCTCG
ACCAATTCTAATTTCCTAGCCTCGGTCGAGGCTACACTGGATTCTTTGCTGCTGAGAGCCTCGCCTGCCAACGAATCTGCCGCAGCGTTGAACTCTCGGA
CCACGTGCAAATACTTCACTGACCGCAGCTTGGTCGTGAGCTCTCGGTGACGATTCAGTTGAACCATCAGAGACTCCTTCCGACATGCCATCACCCCTAG
GGACTGCTGGATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCGTGTTCGAGCGCAGCTGAGACGCCGTTGTTCATTCCAGCATACTCA
GCGAGGTTTACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACACAATCCACGAGCAACTGCCGTATCCAC
CGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAGCAGT
AGGTGACCCTTTCGTCGGCGGTGTAACCGGGGCTAACGAGTCTTCCAATTCCACGAAGCTCGTGAGTCCAGCTTGGAGAAGCTGAGCAAACGTGCAATCA
CGTTCCTTGACTCGGTTAACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTAGATTTGTGCACCCAGTCGA
GCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAACAGTAGCGCTAAGACCTCCTTCTCGGCCGG
GTGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGTAACTTGTCATCATGGTATTGCGTCAAAGTGGAGCTCAATGCCCAC
TCATTCGCGAATAACGTGACATGCGCCTCCTTATCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAGCGCGGCGAAGCTCCGTT
TGGCTGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACACTGCGAAGTCCTGGATGAATCGACTGTAATA
ATTCAGCGCACCGAGGAAAGACTGCATCCCCTTTTTTGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTTCT
GCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGCAGTC
GGTCTAACGTCTCCAGGCACGCATCGAAAGTCTCGGACCCAAAACAGATGTCATCGACAAACGACCGTCGGTCGAACACTGGCACCAACGAGGATTCATC
CGGTTCTCCGGTGGAGAACATGTCGGCCACAGGGCTGTTCACTAACCCATTCACTGCGTCAAGCGTGACCGAGGACTCGCGGTCGGCCTCGAATTTGGTC
AACCGAGTTGTTGACTCCTCGAGTCGTCGCGACGAAGGGTCGGTCACCCCTGCCCGCGCAACCTCGGCGTGGGCTTCGGCTGTTCGCATAAGCTCCGAGA
AGTGGAGCCAGCCGCCTTTGGGTTGGACGAAACCCCACAGAGCATTGTCAATCATTCGCTGGTAAATCATCGGTGCATTCTTCAATCCAAACGGCATACG
AAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCCGCATCGTCATCATAATAGCCCAGAATCCACTGGCCGCGTCAAGCGAG
CAGAACCATAGGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTCACTGCATTCACCAGCTTGTAGTCGA
TGCACAACCGAATATCAACCCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAAAGCCACTAGACGAGCTTTCAGCAAGCC
TTTCAGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGGGCTCTCTGTTTGATGGGTGGATGCCCCTGTACGTCAATATCGCACACCACA
CCGTAGGCCGGTGGTGGCAGAGCGTTCCCGCTCGCAATCATGATCTTCTCGTGTCGTTTCAGCACCGCAACGAGACTTTCTTGTTGACGGGCTGTCGCGC
TCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATAGTCCGTCAACTC
GATCTCATTCGCCAAATGTTCGGACGTATTGGTATCGGTGTTCTCACCACCTGAACCGTCCCCCGTGGTAATATCATGCAGCATTGCTACGAAGGCCGAT
TCCAATCTGATCTCCGGGTCATCACCGAGGACTGGGATAGAGTCCCCTTCACTCGTATACGAGGTATCAGCACCATCAGAGGTGTCGGTCACCACCGAGT
CGTCATCTCCGTCGACCCAACTACTTCCAACAGGTTCGTCAGAGGATTGCATCGTAGTCGTCAACGGCATTCGGTCTCGTTCAGTCGGTTCCTCAGTACT
CCTATCTGCGAACGTTATCTGGCCCTCGTCTAGGTCTCCCAAGTCGTCGGATGGTCACGGTAGGATGCCGCGAGGTGTCGGATAGTCTCGTCGTTCTACA
GCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTGGCGTTCCCGCGCGAACAAAGTCTCGTCTCGACACTCCGCGTACGCCAGGACTTGCCACTCCT
CATACTTAGCGGAGTTCAAACGAGTGTATCCATCTCCTTGTGGCAGGTCACCCCTTTTCACCCAAAGCAATACCGATTCGTGTCTCGCGCAGTGAGCAAT
CTTCGGTGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCCCGTCGAGACCTCGTTACAGTGGGCACCAGGTTCCCAATCCGGCGGGCCCACACGTCA
TGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGCCATGGGACCGACAAATCTTCGGTCGGGCGTCCGGTCACTTGCATGC
TGTACGGCTCGACCTCTGCCGGGTTCTGTGACTTCACCAAGGGCACCATCACCTCGTCCGGTAGTCTCGCAGTGCCGTGGAACAGATCCAACCGGATCCC
GGCTGGAATCATGAAATCCGTTCCCAAGACCACATCAACTCCTGCACTGTGATCCATAATCCATACTTCAAATTCGTACACGCGCTCCCAGCCCAGCGTG
ACTTTAACGAGTGCTCGTCTACGGGTCTCCATCACCCCTGAGTTAATTCCTCGCACTTCCAGACTCCTACCGTGGTCTGGAACTTCGCGCAACCGCAACC
GTTTCGCATATGACGCGGAAATCACACTGACATTCGCACCCGTGTCCAGTAGAATCCTCGTTCGTGAGTCGTTTACAGCCCCATTGACGAGGGCTCGCAA
TCGCTTCCTCTTGTCGTAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATGGATGGTCGATT
TTGGCCATGCTGAGGATCGAAGCTTCGGTTAGCTCCACTCCGTCTCCGTCCACACGTCGTCTATTCACTTCACTCTCACCGAGGCTTACGCCTCTCTCCT
TTACATTTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTTCGCATCCAGCGCAGGTTT
GGCTAACTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGAGA
GGTCCTTCTTCTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACTTCCCTGCATCGTGAACCTGTTTGCACATCTTGCATCGCTT
AAAGCAGTAGTGAGCCGAATGGGTGAGTTCTCCGCAGGCGGCGCACGGACCATATTGGCGTCGACCATCGCGTCCGGTGGAGTTTCGGCGCTGGTCGTCT
CGGTCATACGGGCGTTGGCCATTACTTGCCCTCGGCCGACGGTTGCCGGCCCGAACGAACGTTCCTTCAGCCGCATTGCGACGTTCAGAGTCGTTTGCAG
CAGCCATGTGGCCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCGAGTACCCTTCGGAGTATCGGTCGTCATCGCCAGAGTGAGACTCCGGCCCATACTC
CTCGGTGTCATCATATCCGTCGTTGTACGCTTCCGGGTATCCTCCACGCGTGTCCGCCGAGCGTCCCGCATTCAGTGCTGTCACTATGTTGGTCAGTGCG
TCAGTGAGAGTGACCCTCGGTCGATATTGTTGATCATCCCGGCGACGGTTATCGTCTCGGTAACGGTCTTCTCGACGACGGTCGTCCTCTCGGTGACGTC
GGTCTCGGCGATAGCCGTCCCGCGGATCCTCGGAGCGTCCACCGTCGCGTCGGCGTGCTACCTCTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTCC
AGATTTTCGCTCCCTGCGACGAAGAATATCATTGATCATATCTTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGACGCTCTTCTAGACCTCGG
TCTTCGCACGAATCCAAGAAGTGCTCGACGTGGTCCTTGGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATAGCCGTTGAGTCGGT
TGAGGTAGTCGCAGACATGCTCCTTCTCCTCTCGCTTGGCCGAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCTCGAACAGTAGTACTTAATGAACGC
ATCGCTCAACAATTTCCACGTGCGTCTCGTTTTGCGGGGCAGCTGTCGGTACCAATGCAGAGCACCATCTTGGAGGCTCAATTCAAACGCCATGCACCAT
TCGTTGGGCGGCGTGTGCGTCCCTTTCATCTCGTATATGAAAGCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCCCAAGTACGGCTTGA
TGTTTCCGAGTGGGAGATGCGTAGCGATCTCTAGCCTCGGTGTCGCGCTGTCATTCCCAACAGCGCTCAACTCACGAATCTGGCGTGCCCATTCTCCTGT
CAAGTCACCCCCGGTGTCTCCGACGTCGAACGAATCCTCGTCGGATGAGTCGTCGCGGAGGTCGTAACGTCGACTGGGCGTCCGACTTGCGCTTCGTCCA
GCAGTCGGAGCGGTTCGATATCCCTCGGCCTCTCTCGCCAGTCGTTCTGTACGACTGACCGACCTTGGCGTCACCATGTGAGAGTCTTGGAAATACGTCG
ACGTCGCACCTTGGGCTGAAAATATTCCGGCCTCGGTCGACTCTCTGGGGCGTCTCCCAGGGGTCGATGGCAGTGGAATCATGGACGGATCGACCGGATC
CGATGCGTGGCGGACGTTCGGTGGACGGCTAACTCCCACCTCGGCCACCCCGAAGGCCGACCGAAGCTTCTGCTTCCATTTGCGAAGCGCCGTAGCGGCG
TCCTCGGGTGCCCATGCTCGGAGGTCTGCTTCCGACGGGAACACTTGGGGTTCACATCCCATAGCGCGTAGGAGTTGCACCGTGTCCTCGGCCACCTGCC
GAGTATTCCACGACTCCACGGGCACAGTTAACTCGCCACCGAGCTCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGATCGCATCCAATTGCT
CTTCACCTTCATGAGTTCTAGGTATCGACCCAGAACTCGGTTGGCGGCCGGGGTGTCTCCGTTAAGAGGAGGTCGGCCGCCATTCGGCCGAGAATTCGCA
TCCTCGGCCATCGTCGACGATCGATGATCGTCGGACTCATCTTCGTCGTAACCGTTGGCTGGTTCGGGACCAGCTACTTCGTTCAACTCTTCGGTGAGGT
TTCGCGCAAGCGACCTCACCCCTCCGCTGCGTCCTGCAGATACTGCAGCGGCTTCCGAAAGCTCGGGCATAGCTGCCTTCTCTTCCAGGTCATCTTCTTC
GTCATCTTCCTTGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACGCTCGTTGATCGACGCCAACGTACTCGGCGTCGCGAACGACGAACCG
GAACGCCCCGAACCCTCGGTACGCGTTCCACTTGACCTCGCCGGCGTTGCTGGTACCGCTGACTTCGCTTCTTTCGCCATCTTCTTTCTTCTTCTCTTCT
TTCTTCTCTCGAATGCTCGTTAAGGTAAGAACCTATATGCAACCAAGACACACAGAAGGTCACACCAATCCCGGGTCGCGGCACCAGTTGTCGTGTAGGA
ACACGCAGAAAATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCTTCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCA
GGAACGATCCCTTACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGTTGAGTTCGGTCAACCTTAAAACCTGCACTACTAGCCACGAGCGAGGGCT
AGAATGCAATATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTAAGGGTACCGGCAGTCACGCCTAATACGGGTTTGCCGAGGGTAACCTCGGC
GGGTAGTGAAATACACTTGGGAACACTCGGGTTCCACCAATATATAGGAACCGACACTCCTTGTCGCCCCTAACTCTTGGCCACTCCTATCTCTTGGACT
GACCAGCAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGACCATAAGACAAGCTAGCTAGACTTA
CCGAAGACGGACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTATCCTACAGCTCTGGGAGCCTCTGTAGGTCATCATTTGGCTA
GTCCTATATCTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGCTCTACACAGCCGAGGGTACGATCCGAAATAGGTACAA
ACGAGGCTTTTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTCTGTCGTGTAGGAACACGCAGAAAATCTCACTACCGAACGGTATGACTCCC
ACCAACAACACACGCTTCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCAGGAACGATCCCTTACACCGGGTTGGTTGTAAGCGCCTC
TGTATACCAAGGTTGAGTTCGGTCAACCTTAAAACCTGCACTACTAGCCACGAGCGAGGGCTAGAATGCAATATTGCGCTTTCGCGCGAACCCCCCGCAG
TCCCTCAGAAGTAAGGGTACCGGCAGTCACGCCTAATACGGTTTGCCGAGGGTAACCTCGGCGGGTAGTGAAATACACTTGGGAACACTCGGGTTCCACC
AATATATAGGGACCGACACTCCTGGTCGCCCCTAACTCTCGGCCACTCCTATCTCTTGGACTGACCAGCAACAAACTCTCGGTTCAATGTACCTCAAGCT
CGCTGACAGGCATCCAACGCAGCCGAGCGTATCCAGACCCTAAGACAAGCTAGCTAGACTTACCGAAGACGGACTTGACCCTTGGTGGCTTGTGGGGAAG
ACTGCTGGTTTATTTCTCTTATCCTACAGCTCTGGGAGCCTCTGTAGGTCATCATTGAGCTAGTCCTATATCTCTATACAAATATCAAGTGTAAACAGAT
CTCTGTGGGAAATCGTATAGCCGGCTCTACACAGCCGAGGGTACGATACGAAATGGGTACAAACGAGGCTTTTAACCTCGGCCGGGGTTTTATTAGACCC
AGCCGAGACCTCGGTCACTATTGTTCCTAGGTCACTATAGCGCGGGAAATGAGACCCGCCAATCAAGACGCTCGCCGTTCACTGAAAGGTGCAACGTCAG
CCGGACCGTGACAGTTCGGGTTTTATTAGACCCAACGCCACACCTCGATCACTATTGTTCCTAGGTCACTATAACGCGGGAAATGAGACCCGCCAATCAA
GACGCTCTGTCGCCTTTCACTTAAAGGTGCAACGTCCGTCGGACCTTGACAGTTCGGCTCCAAAACCCAACGCCACAGTCCTATCCTGTGTTCACTCATC
TACGGTGTACGACCGATTATGTGTCTTTTCTATCATTCTCCCATCCTTTCCATCGTCGTCCGTACCGGTTACCTTGACTGATTGTGGCACCTCACCATCC
CATGATCAACAATCGGGCGAGATCCGAGACCCCGGATCTGCCTCTGCTTCATTACAGAGCCAGATCGTGATCCGGGCAAATCTTACTGTGGGGTCAGATC
CCGATCTGGTCAGCTCGGTTCCCAAGGCATCTCCAATTTCGACGACGCTTGATCCAGGTGCGCCATCACTCCCTCAATCTGCGCATCGCCATCTTTGACC
CGACACCGCTTCCCTTAACGATAGTTCCATGGATTGCGGTGTATCTCCAATAGGCCCGGATCTCGACCTGGGCACAGGAGCTCGCCAGGGTTATCCGAGT
GATCTGGCACCCGTAGAGGAATCCATCACTCGTCTCGTACTTTCTGCTCTTTACTTTGGCAGTATCGTCAGCTTAGTCCGGATCCGCCCACCTGTCATAG
TCTCGGGACGGTGACCTCTTCATTTCATTTCCGATCGCATTTTCTGGAGGACACTCCACCACATCTCTTGCTGGGTGACTGGGCCTTGTGGACCGCTCAG
AGAGGGTGTACTCGCTGTGGTATTCGAAAACTAACTGCCGGTGGGCCACTACAAATCGCGATACATCTACTGGAAGGCGCCAATCTCGGCGAGTACACTC
GGGTGAAGCTTCTTCCAGTCTATTACGGTGCTGGCTTCTGCTGCGTGGTCGCCGGGGTGCTGACGACCCCGCTGCGCAACGTTGGATGGACCTTATTGCT
GGAAACATGAATGGGAGCATGTTGTGGTGTTGTAATTCACAAAAACTTCGTTAGTGCGGCTTCCACGCAACAACACAACAATTCGCCGAGTCAGGTCGGC
GTTGTTGGGCTTGCGCAGGGTTCTGTTGGTTCCCTTTGCGGTTCGGCCCAGCCGGGTCCAGTTGAGGCCCTGCTCTCGCTGAGTACCAATCTAAACTCCA
GAAGCTCGCCTGAGCGGGGCAGCTTCCGTTCCTCAAACCCTGTGACCTCCACCAAAGGATGGACGTCGGCGCGCTAGCGCTTTTACAGGTCACCGAGCGC
AGAGTACGCTCAGCTAGAAGATTGCGGTGTCCTGGGTTGTGCAGACCCACCGACTCGTCGATTCGACGAGGTTTGTCTTCGCTGGTAGCGAGAAGTGCCC
ACCCCGGGCCGACCTTGATCTCTTGGCGCTACCAGTCGATTCCCCTACAAGCTATGCCTCTCGGGGAACGACGGCAGACATAATCCAGCCCACGCAGGGA
CTTACCGGAAAGTATACGCTGTTCTTGGACTTAGAAGATTCTGCTCTGTTTTGTTATCTCTGTGTGGCGTTGGGTTTTGGTGCCGAACTGTCACGGTCCG
GCTGACGTTGCACCTTTCAGTGAACGGCGACAGAGCGTCTTGATTGGCGGGTCTCATTTCCCGCGCTATAGTGACCTAGGAACAATAGTGACCGAGGTCT
CGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAAAGCCTCGTTTGTACCCATTTCGTATCGTACCCTCGGCTGTGTAGAGCCGGCTATACGATTTCCCA
CAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCA
GCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTTGGATGCCTGT
CAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGGCGACCAGGAGTGTCGGTCCCTAT
ATATTGGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCCGTATTAGGCGTGACTGCCGGTACCCTTCCTTCT
GAAGGACTGCGGGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGGCCGAACTCAACCTTG
GTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGT
TGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACATCTGTGTCTTCGGGGAGTCCCTTCGAGCTCCCCCCTTTGGTCT
CCTATCGGTCCTATGCAAATACCTAATGAAATGAAGTCGTTATAGATCTCCCTGCGACTCTTCGCTCAGCTTCCTAGTTAATCTTCGCCGAGTCGGGTCG
TTATGGATCTCGACCGACCCTTCGCTCCGATTCCTGATTTATCCTCTCCCACTTGGAATAACTCCAAAATGGAATGCGCTCGCTGAGTCGCTGAGTCTTG
GTGCTCGCCAAGTCCGACTGCTTCGCCGAGTCCGCCGCTTAGGTGCGAACTTCGATTAGGTACGACGTACTTAGCTGAGCCAGACTGGGTGGTCTACCCA
AAATATGAGTTTCCCTACACCACAATGTGCTGCGAGTTCATCTCTCGCTACCAAGAAGTGCTCCGCAATTGTGAGCTGCGCAACCTGGAAGGACCGACCT
ACGCGTATCCGCGCCAGACGTGTTGATGGTCACTTCAGGACCTCTGCCAAAATTCAAGTAGTCACACGTCACAGGGAAAATATGGTGGACACAAATATGG
GCAGCAGCAAATTACTTGTGTTCAGTATGCAGATCTAAACGTCGGCGAAAGCTACAACTGAGTTCTGGTCGAGAGCTACAGGCCCTTGAGTGAGCGCGGT
CCCAGCTAACTGCGCCCTGCATCTTCTGCCGGATGCCACCGCCTTCTTTTGCTGCGCTGCCACTTGGCGCTTCAGTCTCCCTGCTGCTGCAGCTTGCTGA
CGTGCTGCTTTTCGCGCAGCAGTTTCCACCTTGCGTGCAGCTCTTGCTGCCGCTGCTTCCTGTTTCGCTTGATTCTTCGCTTCCGCCGCCGCCACTTTCA
TCTTGACGGCCGCCTCCATCTCCTTGTATGCCAGCAGCTTGCCCCCGGAGACGTTGGCATCGACGAAGTCGCCCTTGGGACGTGGTCTCACTGCGGGCTC
GATCAGCATAGAGAGTGACAGACGTGCCACGTGAAGCGTGTCAAGGCTCAGCCGGGCGCCCTTCATGGCAGCTTGACGCGTTTGGAGACAATTTCTCCAT
GAAATGAGGCTCCAGAACTGCGTGGTGCCGAACCAGTATCGTCGATGAGCGCTCCATTCCTGTTGTCCCGCCCCCAACCATCTTCTGTAGCATCACCTCT
AGAGACAGCGGGAAAATCCCACTGTCTCTAAAGCCGCGTCTCACATTGGCTGACGAAAAGGCAGTTTCAAACGGCCCACACGCCATGCGCGCAACGTCGT
CTTTGACTGCAAGGCCCCCTCCCTGTAGCGGGAAATTTCGAACTGCCGCGTTATACAACGCTTTGTAAGGTTGAAAAACTCCGACATCCAAAGGCTGCAG
AAAGTGGCAGCCCGGCGTCAGCTTCGTCCGATATGTACACTAGCTGGGGGCCACGTCTGCAGGAGATCGGCACAACGCCGCGAATTCGAAGACGAAGCGA
CTCGCGCGTCACTCCAAAACGCTCGGCTGCTTCGCGAATGTACATGCCAGCATCAACGGCGTCGATAGCATGCTGGTAGCGCTCAGTCATTGGCACTTCG
GGGTTATCGGGGTAGAAGAGCTGCAGCATTTTGGTCGGAGGATGGCGAATGTCTTGGGGGCTCTAACTTTCATAAAATGACTCACTCAGGCATGGGCGAG
AGCTTAAAATGCGCGGGGAGCTCTCATCTTCCTCACCAGTGAATCTGGTGCTGGTAAGACACGTTTTGTGGGTGGTATGAATGGCTGGACACAAGGGCTT
GTTTTGCTTATTGACTTGGTTTTGTATACTTCTCCAAAACCATAATCATGTCCAGACCATCAACATGTCTGGCGCGGATACGCACTATGGAGTGCACTGT
TCGCTGTTCCTGTACAGGTGGTGCCCGAGAACGAGGCCAAATATGTACGCTATGGCCGAATGCTCACAAGCTGGTGAAGAGCGTTCCACAGCACCTTCAG
TGATTTCCTGCCAGATTGTAGTGGATTCTGGACTTTCAGCTTGGAATCACCGCAGCGGAACTTCGTTGCTAAGAGATATCCAGATCTGGCGCTGAGCCGG
TGGCTCAGTCGCTGAGTGATGTCTATCACAGATTACCCGGATGTGTCCGACGGCCACCAGGCGTGGACAATGGGTGAACTGTTATGCCAGTAACGGCCAA
GAGTGCCGTACTGAGCTGCATAAGGATTTAGTATTGCCAACTGCATGTTTCCTGTGATGTGGATGCATGTGTACATTCTCAGGCTGTCTGGCAGGTGGCT
ACTGCCTACGACAGTCTGTCTCTCTGGGGGCTCGGCTGGAGGAGAACGAGCTGGTTAGCATCAGACTCATGGTCTTCCTCCGTCCCTCACTTTCCAATCT
TCCAAGTGACCAGCACATCAATATATTCGGCTACTACTTCCGTGCGGGTTGGCCCCCGCATTGCTGTGTTGGAGTTTTTGGTATTCGGACCCGGGAATAC
ACCACAAAGAATTCTTTAGTAGAATTACCACTGTTCGGCCGCCGTCAACAAACTGACTGCGCCTCTCAGTGGCACCGAAGCCATATCTTCAAACCCGACG
ACCGGAATCGTCGGTGGAACTTCAAGAAACCAGTTGCCGTACAAGATGATGCGCGCTGCTGGAATGGACGGCCCGACTGGGACCGTCCCACTCTTCACTC
CGATCCTGCCACCCATGATTGAGTCAGTCTCCCATGAGGCATTAGTGAAGTGGAAGCGGGATCGACGCGACTACGAGTCGAAGATGCAAGCACGCTGCCG
AGTCACAGGCGAGGACTACGACGCGGTGGTGCAGTCGATTCGAGACTCGTTCGAGCCACGACTACTTGACGTATTTTGCGAACTACAACTCAACGTGGAG
TCAGCAAACGCTACGGAGGGCATGCTGACTGCCGAAATCGAGCACATCGTGAGTAGTATCAAGAATGATACACTTCCTGACATCAAGATGCTGTTCAAAA
CGGAGTTGTGCATGAATATGCGCGAGAGCGACGTGAACGCGAGGCTGATCGACTATTACAAGAACTTTACGGACATCGTGGAGGACAACGGTCTGACTGA
GTGCTTCAGCGGAGTCAACGGTACGAAGGAGAAGTGCAAGAGACTGATCGCGAACCTGTTGCCCAAGTCGTTGAAGCAAGAAGTGAAGCAATGCGTTCGT
TTCACGCACGTCGAAGCTGGAAGGGACCCTAGAGCTCTGTTCCGTCTCATCCTCGAGAAGGCGAACGAGTTGGAGCGCCATCATCAGCGACTGCGACAGG
AGAAGCGTAATGCGAATGGGTCAGGCAAGGAGAAGCCTAAGCCTTACCACTCGGCGACATCGAAGAGGCGTTGGGAGTCCAAGACACCAGCTGCGCCGAC
TACACCAAGTCCGGCTGCGATTACAAGTTGGGGTAAGGCCGATCCAAAGACGAAGACTCCATTTTCGTCGAAACCTCCGCCAGGACCATGTCCTAAATGC
CAAGAATTGCATTGGCTGCGTGAGTGCACGCAAGCGACATCGAAGGAGAAAGAAGAACTCCTAAAGAAGATGCGTGAAGCTCGCAAGAGCAAGAAGACCA
GGTTGAAGCGACTTGGTGAGTGCTGCCATCTACTGATCGGGTGGTGACATTGAATGGCAAGCTGGAGCTTCCGTTCTGCCCCGATAGTGGATCGGACTAC
ACCGTGATTGGGCGCTCGCATTGGGAGCAGTTGCAAGCTTTGGACCCCAGTGTGGTCGCAGAGGAGCTTGACGTTCCAATCCTGAACCAGACGTTTGGTT
CAACGACGGTGACGGCCAAGTTGAAGGCCAAACTACATGTAATGATACACACGGCCGTGGGTCCGGTGGAACCCATGAACACCGTGGACGTCCTTGTAGT
TGACATCGATGATGGAGAGTTCATCGTTGGGAATGACCTCCTTACTTCATTGGGGATCGACGTAGATCGCCAATTGGAGCAGCTCGCTACACGCAGTGAT
GATGAAACCAGTGGTGACCCGATTGACTTGGAGGCGGATGAAATGCCTGTCAAGTTGAATGGACCGGGCCCAAGTGGGGATGATGACATTTTTGCTGCTG
TAGAGAGGCTGATTGATCGTGCTGTGACGAATGGGTTTCCGTTGGAGCATGTGGAGAAGCTGCGCACGATCGCACACGCGTACGACGTGTGGCGTTTGGA
ATTGCGTGACGATCCTCCGGCAAATGTGCCACCGCTCGAAGTGCGACTGAAGGATGGGGCTCGTCCAACAAAGTGTAAGCCCCGCAAGTATCCTCCGCAC
ATCCGGAAATTCCTACATGAATTTAATGCTCGTCTTGTGGAACTAGGACTGGTCTATGAGAACCCGAAGAGTCGTTGGTCGAGTCCCGTTCTCCCAGTCA
AGAAGTCGGCAGACTTGATGGATTTGCGGCAGACTACGGACTACAGGGCAAGGAATGAGCAGACTGAAGTCATGGCGGCAGTGATGCCGATTCTTTCTCT
AGTTTTGGAGAATGCACGTGGAATGAAACACTTTGGACTTTTTGATTTTCTTAAGGGGTTCTGGCAATTGCCTTTAGCAGAACTCTGCCAAGAATTCATG
TCCTACATGACCGACGAGAAGATTTACACTCCTCGGCGTGTGCCTCAAGGATGCGCAGATGCTGCCATTCACTTCCAGAAGACAATGGAAGAGTGTTTCG
CATCTCTACTCTACAAGCACCTATTGATTTGGATTGATGACCTCCTGCTGTATGCCGCGGACATCGAGGTGTACCTGCAGAAGCTCGCAGAGCTGTTTTC
GTTGTTGAACCAGTTCGGCTTGAAGCTCAGTGTCAAGAAATCCAGTCTGTACCAAACAGAGGTGAAGTGGTGTGGACGTATGATTGACCACCGTGGTGTT
CGTCATGATCCTGCAAGGATCGACACCTTACGAGCAATACCCTATCCGACGACTGCTGGGGAGCTACAGCAGTTCGTTTGCGCTATTAATTGGATGCGAG
AAAGCATAATTGATTTCGCACGACAAGTCGCACCCTTACAGCGTCGACTCGATGAAGCCCTGGCTAGCACGAAGAGAACTCGTCGTGTAGCCGCAGGCAT
CGAGATCGAGCTTACTCCAGAGGAACGTGCAGCTTTCGACCAAGTGAAGGAGATGTTGGCGACATCCACCACACTTGACTTTCCGGATGATCAAGCCACG
ACGTGTTTGTTCACGGATGCGTCTGATGTAGGCTGGGCTGCGATCATTACTCAAGTCCAAGAGTTTGATCCAACGCAGCCAGCCACGGCGCAACAACACC
GACTTATTCAATGTATGAGTGGGACCTTCACTGGCAGCCAGCTGAACTGGACTGTCATCGAGAAGGAGGCCCTGCCGATTGTGTTAGCGTGCGAGAAGAT
GGATTACCTGTTGCTGCGTCCACAGCCATTTCGGATGTTCTGTGACCACAGGAATCTCATTCACGTTTTCTCACCGCATGAAAGTGTCAAGAAGCACATC
AAGGGCAAGTTGCTTCGATGGGCGATGAAATTGATGAACTTTCGGTACATTGTGGAACATGTACCTGGTCCTGATAACGTATGGGCCGATATGATCTCGC
GCTGGGCGGGCAACCACGCTCCCGTGCCAGCGGTGAAGCGGATCAAGGCGGTGCGCCAACGAACGCCACCGACCCGAGCTAGACTACGACCTCTCGACGA
GGATCAATTTGTGTGGCCTACGCTCGACGAGTTAATTGGGATCCAAACCCAGTATAAACCACCAGCGAGAGCAAAACTTACCGAGGATGGAACGATCACA
GTGGAGGGCAGAATTTGGGTGCCATCGGAAGCAACTGAGCTGATCCAGCGGCTGTGCGTCGTTGCACACTGCGGGGCCCAAGGTCATCGCGGCCAACAGG
CCATGATCGCTCACCTTCGACGCCTCTTTGTGATCGAACATCTTGCGGACATTGTGGCGAAATTTGTGAACGATTGCTTGATGTGCCTGCATAGTCGAGG
GGGGAGGATTATCCCCAGGCCTTGGGGCGAACTGATCGATTGCAGCACACGCAATGGCGTTCTACATTTTGATTTTCTCTACATGGGGGCAAGCTATGGG
GCCAGCAAGTATCTACTAGTCCTGAAAGACCACGCTACGCACTACTGTGAATTGGTGGTGGCAGATACGGCCGATAGCAGAGTCACGACCGAAGCACTTC
TAGCATGGCATTCACGATTTGGTGTGCCACCTATCTGGGTGTCGGACAATGGCTCGCATTTTAAAAACGAGGTCGTCGCCGACCTGAGCCGCCTACGTAC
ACAGCAGACATTTACGCCAGCTTACTGTCCATGGGTCAATGGGTCAGTCGAACGTGTCAATCGTGACATTCTCCAAGTCATCAGGGCGATGATTTTAGCC
TACAAGGTGAGCTACAAAGATTGGGTGTACTTGGTCCCAATGGTGCAGGCGAGTTTGAATCATACTGCTGTGCCATCTCTGGGGAACCATTCACCGACAG
AGCTATTCACTGGGCTACAAACTCCGACTCCGCTCCGCGAATTTTATTTACCTGACTCCAAAGAGCTGCAGGAGATTCCGGAGTCTGAAGAGATCGAGGG
CTACCTAGCAAAACTACGTGAAAGTGTTCAAGCCATGCACTGCGCAGTTGAAGACCAGAGGCTCAAGCAGCGCCTCCTCAACAAGAAGCGTGCGCGCGGT
GAGAATTTGGTGAACTTCACGGTGGGCGATTTTGTACTCCGCTCTCGAGTGGATGAGAAGCAGGGTGACAAATTGCAGGTAACCTAGGTAGGACCGTATC
GTGTGGTACGAGCGGACACTCATTCATTTCGAGTGCAGCATTTGGTGACCGGCGACGAGCTGGACGTGCATGCGTCGAGATTGAAGATGTACACCGATGA
GGACTTTGAGGTGACAGACGAGCTGTTGGAGCATGTCAGATGTACGCCGATGAGGACTTTGAGGTGACAGACGAGCTGTTGGAGCATGGCATAGTGCTAG
CAGTGGACAAACTTGTGAGTCATCGGTTGAACAACGACATCAAGGATTACGAGATTAAAGTCAGATGGAAGGGACTCGAATCGATTGAAGACTCGTACGA
GCCCTTGACTGATCTCGAGAAGGAAATTCGCATCTTGGTGGACAACTACGTACGACCAACAACTCGGTGAGTTTTGGCTGAAGCTGCAACCAGGTGGTGG
ACAGTGTGGGGAACCGACTGGCCCAACCACTTTGACAACTGGTGAAACACGACCGTCTCAGGGAGGCGCGGGACCGGCACGGCGCCGGAAACCCAGGAAA
CGACGACGACAAACTGTAAGTGAACCAGACGTTCAACAGGGAGTCATATCTGCTGGGGACCGAGAACCTCACGTGGATGAAACAAGTTTGGGGCAGACCG
CGACTGGGCTGGATGAGGACCAAGAGCCTCTACAACCTGAAGGTCGCCAAACGCGGTCGAGAACCGCAGCTGCGAGGGTCACGACGAATTCTCGCGGCAA
ACCGAGCCACTCCAATCGACATCGTAGGGACCGAGGCCAGGGCAGCTAATCCGACCGTCGAGTCGAGGGTTGTGACGGTGACCGAGCGATGGAGGCGGTG
AAACCAAGCTTCGGGGGCTGTGTAGTGGATTCTGGGCTTTCAGCTTGGAATCACCGCAGCGGAACTTCGTTGCTAAGAGATATCCAGATCTGGCGCTGAG
CCGGTGGCTCAGTCGCTGAGTGATGTCTATCACAGATGACCCGGATGTGTCCGACGGCCGCCAGGCGTGGACAATGGGTGAACTGTTATGCCAGTAACTG
CCAAGAGTGCCGTACTGAGCTGCATAAGGATTTAGTATTGCCAACTGCATGTTTCCTGTGATGTGGATGCATGTGTACATTCTCAGGCTGTCTGGCAGGT
GGCTACTGCCTACGACCGTCTGTCTCTCTGGGGGCTCGGCTGGAGGAGAACGAGCTGGTTAGCATCAGACTCATGGTCTTCCTCCGTCCCTCACTTTCCA
ATCTTCCAAGTGACCAACACATCAATATATTCGGCTACTACTTCCGTGCGGGTTGGCCCCCGCATTGCTGTGTTGGCGTTTTTGATATTCGGACCCGGGA
ATACACCACGACTTCCGTCGAATGCTGTTTTTACACGATTAAAGCGGGACTCGCCCGGTGGCATTGAGGAAGGATTGCCTCCTCGAGCATTCGCCCACTG
CTTTTCCTTTCGTTGGAGAAAAACGTCAAACGATGTGCAGAGCTTCTCGCCAAAGGCTGTAGCCAGCTTGGATAATTCGTCACCGCGTGTTCGAAACGCG
ACCATCTCTTTAGCAGGAAATTCTTGCGTGGATGTAATAGCCTGGTCCATGGCAGCTACAGCAGCAACCGTCGTTCGCATTCGCTCCGTGACGCTTATAT
CACGCCCCACATCACCTCCCCTGTCGTGTATCACGCCTGTCGAACTTCCTCCAGCCTCACCAGGAAACACCTCCACCGGGGACGTGAAAACTTGCATGTG
CTGTTGGTGAATCTCTACTCGAGCCATCAACCTGGCCAGCACCTCCTCCAGGGAAACACTGTTCTTGAAATGCATCTCCAGCTGATTGTTAAGAGCCTCG
AAATGCTGCATGCTGCTGGACGTCTGGCCGAGAGACTCATCAGACTCATTGGTCCAGTCCTGGATCATTGAGACACGCTGTTGAACCGCGTCGATAGCTT
CGAGGATCTTGTCCACAGAGGTGCCTTTTGCAGAGGCCTTGCCATTCGAAGCCACCACCGGAGATGGAGACACCGAAGCTTCGCCATCCAAAGAGAGTAA
GAAGGCAATATTTTCATCTTCCAACGTGTGCAGCTTCTTTCGAAGATCTCCCTCTACAGCCAACAACTGCACCTCACTCCAGTCAACATCATTCAGCAAA
CTCAGCGCTTCGTTGCTCTCGGGCGAAGAAAGTCGGAGCCCCGATACATCAACGCCCGCGTTATTATCCACAAATTTCCCCCCAGTCTCATCACCTACAG
CGGGGTCTTCTTCCAGAGCGCCATTCTCCTTCATGTCAGCCTTTACCATCAATAGAACCATCAGTACATTCTCCAGCCAATAGATGTAGCCTCAACAACA
GACGCACCACGGAGCGAACAAGGTCGACGTCCAGATCGTACGCCTTCTGCAGACTCAGCTGAGTAGCTGTCTCATGCAGCTCCTCCACATTGAGTCGCAC
CAACCTCGGAAGCGAAATCTACACAACAAAATGCAACACCGCCATCAACGAACCCTTCTACCGTAGCAACTAAGACTTTCCTCGCGTACATTATTTTGCA
CTACAAGAGCACACACACTCCACAGAAACTCGTGCATGGCTGTAGCACTCTCCCTTGCATCCACGAGCCACTGCCACGACGTCACTTCCCCGCTGAAGAA
CAGAGCAAACGCTCCCCGAGTCTTCTCCGGTCCAATTCCATTGTGCTCAATGGTGTCCAGTCCACTCAAATTCCACGAGCTCCGCACGTCCACCGACAAG
TTGCTCAGCAGTTGCACGTAATGCAATTCCAGTTGCGCCGCAGCAGTGGAGTCCTGGATCGTCACACAGAGCACGAAGTATTTGGAGGCATTGGGTCCGT
GGCCAAACAGTCGCTTGGTCTCCGCTGCACTGGATTTGGGCTTCTGTACCTGCACGAAGGAGAAAACGCGCTTGCGACTGGCAGTGGATGCAGACGCACC
ACCACCCGTCGAAGGCCGGGGGGTCGGTTTGGACGAATGGAAGTGCGTGTGCAACGTATGACGGACGTCATCCCGAGAGATACTTCCCAGAGGCTTCACC
TTGCTAGCCTCCATGGCGCTCGATCAATAATGCCAAGGATCGCTACGTCCTTTCGCGTCTCGGACAGTCTTTTTCAAAACTGGGGATGATATTGGGTTGG
GCAGGAGAAGACTTGCCCTCCAACAGCCCGT