Description :
From Genome Similarity Track
Location :
Scaffold_23:265197- 266804
Sequence
1607 bases(100 bases per row)
GCTTTCAGTTTCCTCGAATCAGCCTTCACCTCGCATATAAACTAAACATAAGTTATTAATCAAGGCCTCCATTTATTAGTTAGGGTTTAAATATATATAA
TCAGAGCTACCCAGCACCGATCACATTATATTTGTCTCTCTCTACATTCAACTTCTATGACATCAACTAACCTCATACTTTCAAGACCACTGTCCTGTCT
GATACTGTATTCGGCTTCCGGGACGAGCTTGACAACTGACACCGCTGTGCGCGGATATGGCACAGATGGGTGGGTAATCTATAGACACAAAAAGTTAGTA
TAGTAGTCATGCGAAGCTAGCGAAAAGACCACCGAACTCGTTTTGCTGCAGACACAGGTATCAGCACTGGTAGTTTTATAAATCCTCCTTAAGCAAGCTG
GGGGTAAAGCTGTAATTTTGCGTGGTACCGATAACTTCCGCATTCATGAATGCAGAATATTGTTGCGACATTTCTATGTGCGCCCCGAATTTGAACGACG
GTCTCCGCCTACAGTCATACTTTTAAACGTTAGCGAAAAAGTACGACTACAATAAGGGCTCGCCGTACTACACGCGATTAGATGCTAAGCAGAATAACTG
TGACCTGTTTATCGTGCCTACCTCTTCACTTTTCAGTCTAACCTTATAAAATTCATCTGGTCGTATCTAACGCACAAGAAACTCCCTTTTTTCCGAGTAA
CTATATTTCATTAGGACATTTCTTACGTTCTAGTACGAAGAGATGCGCACCCTCAGGGTGCGCTTACGTTTGTGGAAGCCCGTATGGTCTCGTTTTTATT
CGTATTCCGTTCAGCGCTTAACATCTACGTTTAGGAGCTTTAGTGCATTCGTTGAAGAATACTTCCGATACAATAGTTCCACTGCCCCATTCTTATATCT
TTTAGGGGTGTCAATCGCAATGTATGCCAAATTGTCGGTCATCTGATCAATAGTACGTAAATGTTAGTTTCAATTAGTGATCGTCAGCCGGTCGGCCGGA
AGTATATTTAGCCTTAAGCCGAAGGGGGGGTCACGCTTTCGCGCCTTTGCGGGTTATCAAGCGCATCATACGACCATTCAGAAGAAATTTAAGGTGCCCT
CGGGAAAAATTTACCAGCTCGTCGTTCGGTGAGATTAAAATGGCACCGTCTATCGTGCTGACCGGCTTGTCCTCGTTGAGACTTTAACACGATAATTCGT
TTACCGGCCCGTATATGAAAAGAATTCTTCGTACAGTGGTAGAGGGTATTGCTCACCACGGACCTTCTTGATGCTTAGTGCTACCAGTCTTAACATTGAA
TAGTGTCCGTACAGTGGTAGAGGGTATTGCTCACCACGGACCTTCTTGATGCTTATTGCTACCAGTCTTAACATTGAATAGTGTTAATTATGGTAAGCGC
ATTGTGTAATCTAACGACCTTCCTCTTTCCTCTTCGGTGGAGGCCAACACATCCTTCGCCGGGTTGCGTGGATTTCAAGCCGCGTCATGGTCGCAATTAC
CTGATTTTTCTAGGGCCAGGCATTAAAGATTGCCCTGACTGTTTCTCGTCGGGATTTATACTTCTTTGAGAGACCATACTCAGTAATAGTAATAGGGTTC
TCAAGTA