Description :
From Genome Similarity Track
Location :
Scaffold_336:26519- 30116
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_336-fgenesh-gene-0.1Cytosol aminopeptidase
Pytap_DAOMBR444maker-pag1_scaffold_336-snap-gene-0.15WD domain, G-beta repeat-containing protein

Sequence
3597 bases(100 bases per row)
GCCGCCTCTTCAGCTCCTCAGGCGCTGCGGCGCATCGCCTTGTGCAACAGCGCGTGCAGGgACAaCTCACGCTGgCGTCGgCGgACGCTGCGgCcAaCAC
GCGCGTGgTCTTCGTGACCAAGGAGCAGCGTGAGAGCGACGCTCTTGCCGCAGCGCTGCCCTTCCCAGTCTCCAAGCACGCACTGCGCGACTTCAAGGCC
AAGCCACAAGAGAAGCTATACTTGTACCCGAGCGCTGATGATGAGAGCCTTGCAGACCAGCGTGTGGTGCTCGTGGGTCTTGGTGAGGAGGCCAAGGTGG
ACGAGAACACGCTTCGCAACGCCACGCACGGCGCACTGTCTACGGTCCGTGCGAAGCGTGCCAAAGACGTCGTACTGCAGGTGCCAGCGCTGTCGAAGAA
CGAGTCGTTGAAGCATGAGCGTGTGGTCGAGGTGCTCACGCAGGCGTCGATGCTGTCCAACTACCAGTTCGACAAGTATCTGAGCAGCGACAAGGACGAG
AACGGCGACGACAAGCTCAAGCTGCcACTCGAGAAAATCTTCTTGGACGCCAGCGCCGAGTTCAAGGCGCAAGTCGACGAGCAGATCACTGTGGCCGAAG
AGACGATCTTTGCTCGTAACCTGGGCAACGAGCGTGCTGACGTTGTGACCCCGGcGTTCATGGAGGAGGTGGCGCGTGCGTCGCTCGAGCTTCCCAACAC
GTCGATCCGCGTCCTGCAGCGAGAAGATCTGGAGAAGGAGGGTATGAACATGTTCCTCGCTGTGGGTCAGGCCGCTGTGGTGCCGCCACGTCTCGTGATC
CTCGAGTACAAGGGCAACCCAGAGTCACCAGACGACAAGGTTGCGCTCGTGGGCAAGGGCATCACTTTCGACACAGGCGGTCTCAACCTCAAGCCATCAG
GTTACATTGAAGACATGCACACGGACATGTGCGGTTCTGCGGCCGTGCTGGGTGCCGTGCGTGCGGCGGCTCGCAACGGACTAAAGGTCAACATCGTGTG
TGCGCTGGGCTTGGCGGAGAACGCCATCGGCTCCAAGGCTACCAAGCCGCACACAATCATGAAGTCGCACAAGGGCATCACCGTGGAGAACAACAACACG
GACGCGGAAGGCCGTCTTGTGCTGGGTGACACTCTGTCGTTCGTGCAGTCTGAGTACAAGCCGCACACTGTCATCGATGTGGCGACTCTCACGGGTGCCT
GCATGGGTAAGGACTTCATGCTTCATGGTTCTGTTCGCCGATCTCATGCCAAATGTCTTTGTAGTCGCTCTGGGTGAACACTGCGCAGGCCTCTTCTCCA
ACTCCGATGACCTTGCCTCGAAGCTGCTGGTGCGTCGATTTTTTTCCTTCTTCCAGACCTGCTCAGCCATTCTAACTCCCCATGTGTTCTTACAGGAATC
TGGCACCACGTCCTACGAGCGCTGCTGGCGCTTGCCAATCCTCCCAGAGCACACGGAGGCACTCAAGGGCTCGCAGTCCGACTCTCGCAGCACTGGCAAG
GGCCGCCACGGTGGTGCCTGCACGGCTGCAGCCTTCCTGCAAAAGTTCGTGGACAAGGACGTCAAGTGGGCTCACATCGACATCGCCGGTCCATCCAACT
ACAGTGCCGCCAAGTCCTACTTCCCTCAGGGCGCTACGGGCTTTGGTGTGCAGCTCCTCTACACCTACCTCAAGACTCACGAGCACAAGAACTAAACGTC
TAAGCGAGTCTAATGAATAGAAAAGaGAATAGGAGCTCGGATTCtACTCGGTGTAGACATTCCACACGAATACACAGCCGTCATCGCCCACGGACACGAG
CTGGCGGTCgTCGGGGCTGAACGCTAGGCTGCGTACGTTTCCTGAATGCCCAATGCCGTCCATCAGCAGCTGCCCCGTATTGAAGTCCCAGAGCTTGATC
AGACGATCGTTGCCACCTGTAGCGAAGATGTCGAGAGTGTGTGCGACGGCGATGCACGTGGCCTCTTCGTCGTGGGCTTTCTGGACCACGCTCACTGGCG
CGTCGATGCGGAGATCCCAATATGAAATACGTTTTtCCTGGCCGGCACTGAGCACGAGCCTTTGGTTCGAAGACAGTGCGACAGTGTTAATTCCACCCAT
CCGCTGAATGTGGCTCGATATGCGACGCTCGTTACGgaGATCCCAACACAGAATACTGCGGTCGCGGCTACAGGAGATCACGTGCAAGTCATCCTTGAAG
AGCGTGAGCCCTGTGACGGCCATGGAGTGCTCCTTAAGGTGGGAGACCATATCACGCTTGCGAACATCCCACACGCGAACTTCGCCACCGATGCCAGCCG
ATACGATGAATCGCTGGTTGTGGCTCAGCACTAGCGCCGTCACACCACCAGTATGAGCGTTGTCGATTGACCAAACAGGCTCTCCGGAATCCGAGCTATG
ACACCGAATGCAACCGTCAGTCCAACCCGACAGCAGTACATCGAGCGAGAACTGCAAGCACGTTGGCATGCCGGCGTCGTTGACAACGCTCTTCGTCACA
GCGACATAATCGGATGCATCCCAGATCCGAATTGTGCAGTCACGTGATATGGTGGCAAAACGaTCCGAGACTCCAGCTGCGTATGCAATTTGGACGACTG
CACTCGAGTGATTACTGAATAAGAGATGCGCCGGTAAATACCGTTGGTTGAGCGTCATCTtCACCAAAAAGATCGATCCTGCTTGTGTCCCAACAACTGC
CTCTGTCTGCGTCGCATTGAGTGCCATCCCGGCAATCGGAGCGTCAAGCGTCGCGACACTCGAATCCACGTAGTCGCTATTGAAATACAAAACaCTTCCA
TCCCCGCCGCCGACAAGAACGCCGCTATTGAAGTACAGGATTGAATTGATGCCGCATGAACAGGCTGGCACGCTCTTGAGCAGGCGCCTTGTCTTGACGT
GGACGACGGCAAAGTCACCACTCGTACTGCCTGCGACGAGGGTTTCGCGATCGGGAGAAAACTGTAGGCATGTGAAGTCACGAACGACTGTCTGCTCAAT
CTTGGACGAGGTCAATtCTCCAGTCATCGGATTCAAAACCCAAAGTTGAAGCATCCGGTGGCCGCACACCGCGAACTGGTAGTGGGTGGTGTCGCGTCGT
TTGATATCACGCGCCATACCACCAAACACGACGGCACTTACCATTGATGAGAGCTTTTGGTGTGTGGCGCAGATGTTACCCGTGTACAGGTCCCAAACAT
AAAGCCGACCATCTTCGGGAGCCCCTATTGTGCACAACAACCGCTCATCGTCCGAGAATGCGAGGGCTGCGATGCCGTGGTCATGCTCCGAGAGCCGGTA
CACGAGCTGCTTGTTGTTGTAGTCCCAAACCAGTACATCTGCACGGCGACCACGTTCCCcTGAGGCTATCAGCCGCCCGGATGATGACATTGCCATGCAG
GAAATGGCAGCATCGTGACCTCGGAGGAACGTCTGACTGTGTGCATCGTGGAACGCCGTCAGCAAAATCGAACCACCCGTGGTGTACACGTAGTCAAGCC
CAGACGGATGGTAGAAGATCGAgTTGGGTATCGCCGAGAATCCGATCGTCCGCTCTAGTTCTATTGCAATAGGTGAGATTGTCGACGTGTCGTGCGG