Description :
From Genome Similarity Track
Location :
Scaffold_127:26517- 31320
Transcript NameFunction/comments
Physo_143016hypothetical protein
Physo_109528polyprotein

Sequence
4803 bases(100 bases per row)
GGTTATGAGCCCAAGGCTCACGCGAGGGGAGCACAGCAACTAGGACGTCATGGCGGAGCAGAAGAAGACGCCCAAGGAGTCACAAGAGGAGAAGAGGACG
ATCCCGCCGTTTGACGGCAAGGACTACGAGGTCTGGCACGAGCGAGTCAAGCTCAAGCTGGAGAGGAAGAAGCTGTGGAAGTACTGCATGGAGGACTTGC
TCGAGCCGGACGAGAGCAAGGAGGCAGACGCGCACGCGACGTGGACGAGCGAGATGGCCCACGCCAAGGAGATCATCTACGACGCAATGACGAATCGTAT
TATGAAGACTGTGAAGTATGAACCCACCCCGTTTCGTGTGATGGAGCGCTTAAAAAAGAGATTTATGGGCAAGACGTACCTGAAGTACGCTGAGGAGAGG
GCCAAGCTCAGTCGGCTACGGCTCGCTCCCAACGGCAATGTGCCAGATCACCTGAGCGAGATGCGTCGGCTGATGGAGACCATTGCTGGAGTCGGGCGTC
CTGTGGACGAGTATGTAAAGCCAGCACTATTGATTGGATCTCTGCCGCGCGAATATGATCATGTTGTACAGACGTTTCTCGCCAGTCACAAGCACCAAAA
TGCTGATGATCCTCCTAATGATGAACAACTTGAACTCGCATTGGAGATGGCTTACGACCATCGCCAAGGTCGGAAAGCAGAGGGCGCCAAGGACAATGAT
GATGAAGAAGAGGCGTTCTTTGCTGGTGGAGGAAGAGGTCGAGGACGTGGTCGCGGCCGTGGACGTGGTGGTCGATCTGGAGGACACGGGCGCGGTTCCG
GTGGTGGACATGGTTCTGGCGGTCGCGGGAGCCAAGGTGGTGGACGTGGAGCTGGACGTGGCCAAGCCGGCAGTGGACAAAAGCCAGGTGGTGCTTGTTA
TCACTGCCATGAAGCAGGGCATCATGTGGTTGATTGCCCGTTTCTTGGCAAGCGACCTCCAGCCGAGGATCGCAGCAGCACCCAAGCTCAGAAGCGCGTG
AAGATGAGTGGAGGAAAGAGTGCTAAGGCTGCTGAAACGAGTAGCTACGCTAATGAAAGTGATGACAGCGCGTATGTTATTCTTCAAGTGATGAAAATGA
AAATGCCGGTCGCAGACAAAGCCCATGATAACAGGTACCTGGACTCTGGTGCATCGAGTCATATTTCGAACCAGCTCACTGATTTCATGGAGTTCACGCC
TCTTAGCGCCCGGATTCGAGTTGGAGGAAAGAACTCGCTGGGTGTTGAAGGTATTGGTACTGTGGTTAAAGAGCTGGAGACTACTGGTGGGAGGTGCTCA
CTGACGCTGCGAGGAGTTCGTTATGCTCCAGAGCTGCAGTGCAGTCTCTATTCTGTGCGACGGCAACTGAACCAATATCTGCCTGAACGTGATCGTGTGA
AGGTGCACTTTGATGAGGCAGATCGCGCTGATGTTATCTTACAGGCTGGCGTGACTATCGCTCAAGTTGATTATACCAATCTCTATCGCTTGAAGTTGGA
GAGACCCCAAGAGGTAGCCATGGTGGCGCTACCAGCTCGAGTGAGTAGTTTGGAGCTGTGGCATTCGAGATTGGGGCACCCTGGCAAGAACGCGTTTAAT
GCGCTGTTCAGCCATGATCAGTGGCCGTTGCCACATGTGAACTTGCGTATCCCGGTGGGTTTCAATTGCGAGACCTGTGTGAAGGGTAAACTTACGAGGA
AGAGCATGAAGAAGTCTTGGACACAGACCCGCGAGTGGTTAGTTGGCGAAAAGGTCCATGTGGACTCTTGGGGTCCGTATGCAGAGCACTCCTACGGTGG
TAAACGGTACTTTGTCGTGTTCGTTGATGATGCGAGTCGGTTTGTCACCGTGTATCTTCTGGAGCATCGTTCGGAAGTGTACCAGAAGTTTGAGGAGTAC
TATCAACGCGTCAAGACGCAGCAGCATGTCAGAATGAAAGCGCTAAGGTCAGACAATGCAAAGGAGTTCAAGAAGCTGCAAAGTACATGTGACACGAAGT
ATGGTATGGAGTTTGACAGCAGCATCAAGCATACTCCGGAGCAAAATGGTGTCGCGGAGAGAATGGTCCGCACCATTACGGAGAGAATGCGATGCATGCT
CGTGCACTTCGACCTGCCTGAAGCGATGTGGGGTAAGGCAGCGATGACAGCTGCATACTCCGTGAACATTATGCCAAGCTCGGTTTGAGGCATGGAGGTA
CCGTATGCAGTATGGCACCGTCAGACTCCTGCTTGTGAGAAGTTGCGGACGTTCGGCTGCGCCGTCCTGTCGTACATCGACAAGGTGGAGAGACGGAAGA
TGCAGGCGAAAGCACGGGGGGCGGTCTTCGTTGGATATTCGCGAGAGAAGCGAGGCTATCGCTTGTTCGATAGCAAGACCAACAAGGCATTCTACAGCCA
TACTGTCGTGTTCTATGAGAATAAAGCTGGTCGATTGCTCATGGACTCGGCATCAACGCCAAGTGCAGCCTCCGGTAAGGAATATTTAGGCGTTGATCGA
TCAGTAGAGGATGACATTGAGCCAATGCTGGATGAAATGCATGATGACTCAAATGATGGAGGTAGTTATCGTGATGATGGAGATTGCTGGACTGGTGGGG
CCAGCGACTCCAGAGACGGAGGTGATTATCGGACTGGTGGGGCTGATGACACCCGATGTGATGACCGACCAGGTGGGGCAGTTGAGCAAGATGTCCGGTC
AGATGGGGCATGTGGGTCCAAGAAGAGAGGCCCCGGTGGTGATGCCGCAGCGCCTCGACCAAAGAGAGTGCGGTTTGCGGTGTTTGAAAGTGGACGTTCT
AGCAAGGTGGCAGAACGAGATGAAGGACGTGGAGTGAGCTCTACAGCATCTGGATGTGATCGTTCTAGCAAGGTGGCAGAACGTGATGAGGAACGTGTCA
ATGGACATGAGGCAGACCACCTGCGAGGTGAGTGCGTGCCAGGCAATTCCAAAAGAAGGAGAAAGAGGAAACGCAGCAGTGGGCGGTACAAGGGACCGGC
TGCTGACGAGACGAAGGCTCTACCAGGGAGTCAAGAGGTGGAAGAGGTGGACAGTAGGTCATCGGCTGCTGAGCGGGCCGACTCGGACAGCCAAGTGTCG
AGTGATGCTGCGAGTGTGGGGCGTCTATCAACGCCTCCTTGCACAGCACTTCGTGAGTACACAGGCCCGAGAGGCACTCGCCCTAAAGACCCTCCAGTGA
CACGGAGCGGTCGGGTAAGTAAACCGCCCACGTGGTTCGGTGACTACGTCTACATTGCCTACGAAAATACAAATCCAGATGATGATGTGAACTCGTTGCC
TGCTGGATGGAGGAAAGCACGAGCTGAGTTGCAACGTGCTATGGCGAACGAGTTGATACTTGCATGGTGGGAGGACTATTGCTGCATGAGTACTGGCGAG
TTTGAAGAGCCAGATACTTTCGGTGACGCTATGGAGAGTGAGCACTCATTGCAATGGAAAAATGCAGCTGATGATGAGTTTGATTCGTTGATGAAGAACG
ATACCTGGGAGTTGGTGCCGCGTGAGAAGCACATGAAAGTGCTGCAGAATCGCTGGATCTTTCGCGTCAAGTATCTAGCAAACGGAGAGATCGAAAGATT
CAAAGCGAGGCTCGTGATCAAGGGCTTCATGCAGATTTATGGTATCGACTACCTAGAGGTGTACTCGCCTGTTGTGAGGCTGGAGACACTGCGTGTTCTC
TTGACACTGGCGGCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCATCAACAAGATGAAGAAGATGTTCGAGG
ACCGGTTTGCGATGAAGGATCTCGGGGCGTTACACTACATTCTAGGCTGGGAGATCACGCGGAACCGGGCCGAGAGAACGATGTTCATTGGTCAGCAGAA
GTATGCCGAGACCGATCCTCAAGCGGTTCAACATGCAGGACTGCAATGGCTGCAAGACGCCGAGCACGGCGGATCTGAAGCTGAGCAAGGCCATGTGTCC
GACCGAAAACGATGAAAGGCAACTGATGAGATCGACGCCATATCGTGCTGTGGTTGGCAGCCTGATGTACCTGATGCTCGGTACCCGACCCGATCTGGCC
TACCTAGTTAGAGAGTGCAGTCAGTTCTTGGAAAACCCAGGTCTGTTGCATTGGAGAGCTGCAAAACGTGGATTGCGCTACCTGAAAGACACAGCGGACT
GGGGGGTCCAGCTTGGTGGCCTAGCGTGGTCAGATCAAAAGCTGGATGATCATCTGAGAGCATACGCAGATGCGGATTTTGCAAATCGAGTTGATGATCG
AAAGTCTGTTGCAGGCTACGTGACTCAATTTTGTGGGAGCATCATTTCGTGGAGCAGCCAGACGGAGAAGACCGTCGCGCTGCACACGACCGAGGCCGAA
TATATGGCTCTTAGTCTACTGGTGCAGGAGGTGGTGCACTTGCGCCAAATGCTGAAGGAGCTGCAGGTGCAGCAAATTCAGCCATCCCAAGTCTTTGTTG
ACAACGAAAGTTCAAAGAAGCTTGCCAGCAACCCTGTGTTTCATTCTCGGACCAAGCACATCGATGTGCGCCACCACTTCGTGCGTGAGCGCATCGATTT
GAAGGAAATTGACGTGCTTCGGGTGCCAGGAGTTGATAACATGGCCGATGCTTTTACAAAGCCATTGGCACGTCCGGCATTTGAAAAACACAGAGCTGCA
ATGGGATTATTGCCAAGGGCAAGATTTGGAGATGCAAGTTGATGGGAATCCGTAGGTGGGGCTGTTGCGGATTATACTGATCTCCACTATACTACTTGCA
GTT